Incidental Mutation 'R4829:Ptpn21'
ID372693
Institutional Source Beutler Lab
Gene Symbol Ptpn21
Ensembl Gene ENSMUSG00000021009
Gene Nameprotein tyrosine phosphatase, non-receptor type 21
SynonymsPTPD1, PTPRL10
MMRRC Submission 042445-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.550) question?
Stock #R4829 (G1)
Quality Score174
Status Validated
Chromosome12
Chromosomal Location98676741-98737405 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 98689296 bp
ZygosityHeterozygous
Amino Acid Change Serine to Alanine at position 471 (S471A)
Ref Sequence ENSEMBL: ENSMUSP00000152639 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000085116] [ENSMUST00000170188] [ENSMUST00000221148] [ENSMUST00000221535] [ENSMUST00000221932]
Predicted Effect probably damaging
Transcript: ENSMUST00000085116
AA Change: S471A

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000082197
Gene: ENSMUSG00000021009
AA Change: S471A

DomainStartEndE-ValueType
B41 19 222 5.04e-69 SMART
FERM_C 226 312 4.66e-26 SMART
low complexity region 332 343 N/A INTRINSIC
low complexity region 563 574 N/A INTRINSIC
low complexity region 710 724 N/A INTRINSIC
PTPc 897 1171 7.31e-111 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000170188
AA Change: S471A

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000126975
Gene: ENSMUSG00000021009
AA Change: S471A

DomainStartEndE-ValueType
B41 19 222 5.04e-69 SMART
FERM_C 226 312 4.66e-26 SMART
low complexity region 332 343 N/A INTRINSIC
low complexity region 563 574 N/A INTRINSIC
low complexity region 710 724 N/A INTRINSIC
PTPc 897 1171 7.31e-111 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000221148
Predicted Effect probably benign
Transcript: ENSMUST00000221535
Predicted Effect probably damaging
Transcript: ENSMUST00000221932
AA Change: S471A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.11 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 92.8%
Validation Efficiency 98% (109/111)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. This PTP contains an N-terminal domain, similar to cytoskeletal- associated proteins including band 4.1, ezrin, merlin, and radixin. This PTP was shown to specially interact with BMX/ETK, a member of Tec tyrosine kinase family characterized by a multimodular structures including PH, SH3, and SH2 domains. The interaction of this PTP with BMX kinase was found to increase the activation of STAT3, but not STAT2 kinase. Studies of the similar gene in mice suggested the possible roles of this PTP in liver regeneration and spermatogenesis. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 95 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik T C 3: 138,069,019 V1323A probably damaging Het
1700029J07Rik T C 8: 45,967,915 I159V probably damaging Het
1700061G19Rik A G 17: 56,883,500 probably null Het
Abcb1a T C 5: 8,723,214 L814P probably damaging Het
Acat1 C A 9: 53,591,456 G191V probably damaging Het
Adamts20 A T 15: 94,326,396 D1184E probably benign Het
Adssl1 T C 12: 112,634,713 L283P probably damaging Het
Arid4a A G 12: 71,023,498 probably null Het
Arid4b T A 13: 14,184,438 D599E probably benign Het
AW146154 T C 7: 41,480,633 K353R possibly damaging Het
Axdnd1 G T 1: 156,376,646 R547S possibly damaging Het
BC067074 A G 13: 113,368,162 I1942V probably benign Het
BC147527 G A 13: 120,308,390 C82Y possibly damaging Het
Bcat1 A T 6: 145,015,475 F134Y probably damaging Het
Camk2d C A 3: 126,779,997 probably benign Het
Catsperg2 T G 7: 29,701,125 K268T probably damaging Het
Ccar1 A C 10: 62,745,335 F1103L unknown Het
Ccdc141 T A 2: 77,074,916 E395D probably damaging Het
Cdc37l1 A G 19: 28,990,583 T16A probably benign Het
Cdca2 T A 14: 67,693,753 probably null Het
Cntn5 T G 9: 9,976,283 K219Q probably damaging Het
Col23a1 C A 11: 51,557,586 A202E unknown Het
Csmd1 G A 8: 16,127,296 L1318F probably damaging Het
Csnk1g3 C T 18: 53,895,823 A16V possibly damaging Het
Dab2 A G 15: 6,424,681 D224G probably damaging Het
Ddr1 A T 17: 35,685,113 C625S probably damaging Het
Dennd4a T C 9: 64,889,056 V788A probably damaging Het
Dgcr2 T C 16: 17,842,753 E402G possibly damaging Het
Dhcr7 T G 7: 143,837,917 I81S probably damaging Het
Exd1 C T 2: 119,520,326 A485T probably benign Het
Fat1 C T 8: 45,036,162 T3467I probably damaging Het
Fblim1 T C 4: 141,584,709 E235G probably damaging Het
Fbxo38 T A 18: 62,518,591 M548L probably benign Het
Fstl5 T C 3: 76,322,182 Y97H probably damaging Het
Glb1l A T 1: 75,200,350 S481T probably damaging Het
Gm7102 C T 19: 61,175,926 G24R unknown Het
Gp2 A T 7: 119,457,184 V22E possibly damaging Het
Grin1 A G 2: 25,318,724 S55P possibly damaging Het
Herc2 A G 7: 56,106,492 D760G probably benign Het
Hpn A G 7: 31,098,875 probably benign Het
Hsf2 T C 10: 57,496,170 V73A probably damaging Het
Ighv1-42 T C 12: 114,937,168 Y80C probably benign Het
Ighv1-64 T C 12: 115,507,726 K57R probably benign Het
Klc1 T C 12: 111,795,603 I569T probably damaging Het
Klra3 T G 6: 130,323,616 K263N probably benign Het
Lrcol1 C A 5: 110,354,527 H90N probably benign Het
Mamdc4 T C 2: 25,565,356 E921G possibly damaging Het
Mark1 G A 1: 184,905,527 R622W possibly damaging Het
Mdga1 A G 17: 29,846,369 S696P possibly damaging Het
Mmp1b C T 9: 7,370,729 probably null Het
Mtnr1a T C 8: 45,085,615 probably benign Het
Myo5a T C 9: 75,136,407 I226T probably damaging Het
Ncoa6 G T 2: 155,415,227 P799T probably damaging Het
Npc1l1 C T 11: 6,214,010 probably null Het
Nxph3 T C 11: 95,511,495 E31G probably benign Het
Obscn T C 11: 59,054,246 I4649V probably null Het
Olfr1100 G A 2: 86,978,574 S74L probably damaging Het
Olfr875 G T 9: 37,772,947 C96F probably damaging Het
Olfr955 A T 9: 39,470,367 Y120N probably damaging Het
Olfr960 A T 9: 39,623,438 H103L probably damaging Het
P3h3 G A 6: 124,841,638 probably benign Het
Pcnx2 A T 8: 125,861,058 probably null Het
Pirb C T 7: 3,717,603 G299S probably benign Het
Pla2g4d A G 2: 120,266,743 S792P probably damaging Het
Plppr4 A T 3: 117,335,591 L76M possibly damaging Het
Ppp2r3a A T 9: 101,212,510 S205T possibly damaging Het
Prkdc G A 16: 15,702,075 D1126N possibly damaging Het
Prrt4 G A 6: 29,177,182 S196L probably benign Het
Ptprk C A 10: 28,580,484 S9* probably null Het
Rassf4 A T 6: 116,645,142 I163K possibly damaging Het
Rgs22 C A 15: 36,103,888 R142S probably damaging Het
Rit2 C A 18: 31,212,673 L73F probably damaging Het
Rrbp1 A C 2: 143,989,687 S187A probably benign Het
Rspo2 A T 15: 43,093,187 Y83* probably null Het
Scn5a C T 9: 119,534,707 V456M probably benign Het
Scn9a T A 2: 66,551,713 H290L probably benign Het
Smarca4 T C 9: 21,639,327 I452T probably damaging Het
Smc2 T A 4: 52,449,612 I198K probably damaging Het
Smim14 G A 5: 65,460,603 probably benign Het
Spg11 A C 2: 122,108,455 N339K probably benign Het
Spta1 A G 1: 174,237,927 E2014G probably benign Het
Stk4 T C 2: 164,099,827 probably null Het
Sypl C T 12: 32,967,646 T121M probably damaging Het
Tas2r120 T A 6: 132,657,368 F138I probably benign Het
Tet2 A C 3: 133,476,620 C1194W possibly damaging Het
Tex29 T C 8: 11,855,668 probably benign Het
Tnfrsf22 T A 7: 143,643,330 T91S possibly damaging Het
Tnik A T 3: 28,539,541 probably benign Het
Tnr A T 1: 159,858,404 I402F probably benign Het
Unc93b1 A T 19: 3,944,293 S475C probably damaging Het
Utrn T A 10: 12,663,461 E1937D probably benign Het
Vmn1r227 A T 17: 20,735,665 noncoding transcript Het
Vmn2r101 G A 17: 19,611,967 V742I probably benign Het
Vmn2r81 T C 10: 79,247,801 L3P possibly damaging Het
Zfp882 T G 8: 71,914,389 H353Q probably damaging Het
Other mutations in Ptpn21
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00093:Ptpn21 APN 12 98680468 missense probably damaging 1.00
IGL00576:Ptpn21 APN 12 98733601 missense probably damaging 1.00
IGL00577:Ptpn21 APN 12 98733601 missense probably damaging 1.00
IGL00580:Ptpn21 APN 12 98733601 missense probably damaging 1.00
IGL00583:Ptpn21 APN 12 98733601 missense probably damaging 1.00
IGL00773:Ptpn21 APN 12 98688313 missense probably benign 0.00
IGL00780:Ptpn21 APN 12 98680371 missense probably damaging 1.00
IGL01516:Ptpn21 APN 12 98715189 missense probably damaging 1.00
IGL01616:Ptpn21 APN 12 98680013 missense probably damaging 1.00
IGL01939:Ptpn21 APN 12 98689161 missense probably damaging 0.96
IGL02237:Ptpn21 APN 12 98705092 critical splice donor site probably null
IGL02512:Ptpn21 APN 12 98679392 missense probably benign 0.00
IGL02852:Ptpn21 APN 12 98715195 critical splice acceptor site probably null
IGL02894:Ptpn21 APN 12 98689632 splice site probably benign
IGL03024:Ptpn21 APN 12 98680056 missense probably benign
IGL03220:Ptpn21 APN 12 98678623 missense probably damaging 1.00
R0144:Ptpn21 UTSW 12 98688609 missense probably benign 0.01
R0472:Ptpn21 UTSW 12 98704240 splice site probably benign
R0675:Ptpn21 UTSW 12 98688216 missense probably benign 0.16
R0771:Ptpn21 UTSW 12 98689080 missense probably damaging 1.00
R1434:Ptpn21 UTSW 12 98688590 missense probably damaging 1.00
R1470:Ptpn21 UTSW 12 98688476 missense probably benign
R1470:Ptpn21 UTSW 12 98688476 missense probably benign
R1837:Ptpn21 UTSW 12 98733626 missense probably damaging 0.99
R1897:Ptpn21 UTSW 12 98680405 unclassified probably null
R2048:Ptpn21 UTSW 12 98689526 missense possibly damaging 0.94
R2376:Ptpn21 UTSW 12 98688314 missense possibly damaging 0.62
R3709:Ptpn21 UTSW 12 98688541 missense probably benign
R4197:Ptpn21 UTSW 12 98680138 missense probably damaging 1.00
R4283:Ptpn21 UTSW 12 98733475 missense probably damaging 0.99
R4368:Ptpn21 UTSW 12 98678593 missense probably damaging 1.00
R4397:Ptpn21 UTSW 12 98688248 missense probably damaging 1.00
R4397:Ptpn21 UTSW 12 98715060 missense probably damaging 0.98
R4703:Ptpn21 UTSW 12 98679392 missense probably benign 0.00
R4737:Ptpn21 UTSW 12 98708844 missense probably benign 0.03
R4926:Ptpn21 UTSW 12 98715195 critical splice acceptor site probably null
R4974:Ptpn21 UTSW 12 98680103 missense probably damaging 1.00
R5022:Ptpn21 UTSW 12 98679407 missense probably damaging 1.00
R5057:Ptpn21 UTSW 12 98679407 missense probably damaging 1.00
R5395:Ptpn21 UTSW 12 98715117 missense probably damaging 1.00
R5608:Ptpn21 UTSW 12 98688777 missense probably benign 0.00
R5741:Ptpn21 UTSW 12 98679289 missense probably damaging 1.00
R5785:Ptpn21 UTSW 12 98682550 missense probably damaging 0.99
R5959:Ptpn21 UTSW 12 98708889 splice site probably null
R5968:Ptpn21 UTSW 12 98710890 missense probably damaging 1.00
R5984:Ptpn21 UTSW 12 98689076 missense probably damaging 1.00
R6005:Ptpn21 UTSW 12 98678552 makesense probably null
R6181:Ptpn21 UTSW 12 98699999 missense probably damaging 0.99
R6226:Ptpn21 UTSW 12 98680116 missense probably benign 0.24
R6226:Ptpn21 UTSW 12 98715172 missense probably damaging 1.00
R6317:Ptpn21 UTSW 12 98689262 missense probably damaging 1.00
R6370:Ptpn21 UTSW 12 98689034 missense possibly damaging 0.86
R6485:Ptpn21 UTSW 12 98698872 nonsense probably null
R6894:Ptpn21 UTSW 12 98715181 missense probably damaging 1.00
R7122:Ptpn21 UTSW 12 98688912 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TCAGTTCAGGCACACTCACG -3'
(R):5'- TACAGTGCACACAGTACGAATTCC -3'

Sequencing Primer
(F):5'- ACCACTGGCCGCCTCTC -3'
(R):5'- GTGCACACAGTACGAATTCCTTAAAC -3'
Posted On2016-03-01