Incidental Mutation 'R4830:Myoz1'
ID372759
Institutional Source Beutler Lab
Gene Symbol Myoz1
Ensembl Gene ENSMUSG00000068697
Gene Namemyozenin 1
Synonyms2310001N11Rik, FATZ, calsarcin-2
MMRRC Submission 042446-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4830 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location20649107-20656540 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 20655309 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 14 (K14E)
Ref Sequence ENSEMBL: ENSMUSP00000087955 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057090] [ENSMUST00000090469] [ENSMUST00000117386] [ENSMUST00000119483]
Predicted Effect probably benign
Transcript: ENSMUST00000057090
SMART Domains Protein: ENSMUSP00000053176
Gene: ENSMUSG00000039376

DomainStartEndE-ValueType
PDZ 15 85 3.52e-10 SMART
low complexity region 101 112 N/A INTRINSIC
low complexity region 151 162 N/A INTRINSIC
low complexity region 202 230 N/A INTRINSIC
low complexity region 243 257 N/A INTRINSIC
low complexity region 429 444 N/A INTRINSIC
low complexity region 500 518 N/A INTRINSIC
low complexity region 530 540 N/A INTRINSIC
low complexity region 563 580 N/A INTRINSIC
low complexity region 591 604 N/A INTRINSIC
low complexity region 700 726 N/A INTRINSIC
low complexity region 781 797 N/A INTRINSIC
low complexity region 867 880 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000090469
AA Change: K14E

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000087955
Gene: ENSMUSG00000068697
AA Change: K14E

DomainStartEndE-ValueType
Pfam:Calsarcin 1 296 1.9e-105 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000117386
SMART Domains Protein: ENSMUSP00000112792
Gene: ENSMUSG00000039376

DomainStartEndE-ValueType
PDZ 15 88 1.34e-15 SMART
low complexity region 104 115 N/A INTRINSIC
low complexity region 154 165 N/A INTRINSIC
low complexity region 205 233 N/A INTRINSIC
low complexity region 246 260 N/A INTRINSIC
low complexity region 432 447 N/A INTRINSIC
low complexity region 503 521 N/A INTRINSIC
low complexity region 533 543 N/A INTRINSIC
low complexity region 566 583 N/A INTRINSIC
low complexity region 594 607 N/A INTRINSIC
low complexity region 703 729 N/A INTRINSIC
low complexity region 784 800 N/A INTRINSIC
low complexity region 870 883 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000119483
SMART Domains Protein: ENSMUSP00000112760
Gene: ENSMUSG00000039376

DomainStartEndE-ValueType
low complexity region 203 218 N/A INTRINSIC
low complexity region 274 292 N/A INTRINSIC
low complexity region 304 314 N/A INTRINSIC
low complexity region 337 354 N/A INTRINSIC
low complexity region 365 378 N/A INTRINSIC
low complexity region 474 500 N/A INTRINSIC
low complexity region 555 571 N/A INTRINSIC
low complexity region 641 654 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224436
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224472
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225231
Meta Mutation Damage Score 0.224 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.5%
Validation Efficiency 97% (71/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is primarily expressed in the skeletal muscle, and belongs to the myozenin family. Members of this family function as calcineurin-interacting proteins that help tether calcineurin to the sarcomere of cardiac and skeletal muscle. They play an important role in modulation of calcineurin signaling. [provided by RefSeq, Apr 2012]
PHENOTYPE: Mice homozygous for a knock-out allele show reduced body weight and fast-twitch muscle mass, a fiber type shift toward more oxidative fibers, increased exercise capacity and calcineurin activity, and enhanced muscle regeneration after cardiotoxin injury. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcd3 C A 3: 121,760,284 G643V probably damaging Het
Adamtsl1 A G 4: 86,356,382 E1225G probably damaging Het
Agbl5 G A 5: 30,890,715 R111H probably damaging Het
Ankle2 A C 5: 110,242,013 K446Q probably damaging Het
Boc A C 16: 44,490,157 M800R probably damaging Het
Ccnt1 A T 15: 98,543,451 N645K probably damaging Het
Cd93 G A 2: 148,443,379 Q16* probably null Het
Cpsf4l G T 11: 113,709,502 probably benign Het
Cuzd1 T A 7: 131,318,054 D111V probably damaging Het
Dab2 T C 15: 6,427,527 C232R probably benign Het
Dmpk A T 7: 19,087,528 Y237F probably damaging Het
Dnah6 T A 6: 73,044,762 T3526S possibly damaging Het
Dock2 T C 11: 34,273,767 probably null Het
Dsp G A 13: 38,192,864 V1542I probably benign Het
Dst T A 1: 34,198,505 probably null Het
Esd T C 14: 74,741,160 L54S probably damaging Het
Exd1 C T 2: 119,520,326 A485T probably benign Het
Gm3604 A T 13: 62,369,043 N500K probably damaging Het
Gm7102 C T 19: 61,175,926 G24R unknown Het
Grhl2 T A 15: 37,335,659 probably null Het
Gsto1 C T 19: 47,864,391 R222C probably benign Het
H2afy2 C T 10: 61,739,353 D355N possibly damaging Het
Inpp4a T A 1: 37,371,780 M343K probably damaging Het
Itpripl2 T C 7: 118,491,057 Q93R probably benign Het
Jakmip2 G A 18: 43,567,143 T450I probably benign Het
Kdm6b A T 11: 69,403,794 I1186N unknown Het
Kif1a T C 1: 93,021,209 probably null Het
Klhl20 T C 1: 161,098,376 K434R probably benign Het
Lemd3 T C 10: 120,931,948 D697G probably damaging Het
Lipo1 A G 19: 33,776,587 S383P probably damaging Het
Ltn1 C A 16: 87,379,694 K1741N probably damaging Het
Lvrn A T 18: 46,905,351 T991S probably damaging Het
Mast3 C A 8: 70,788,915 R151L possibly damaging Het
Muc4 G C 16: 32,753,919 R1265P probably benign Het
Neb G T 2: 52,192,520 Q5450K probably damaging Het
Nedd1 T A 10: 92,686,258 N639I probably damaging Het
Nlrp4e A T 7: 23,336,740 N673Y probably benign Het
Nop53 C T 7: 15,942,204 R190Q probably damaging Het
Notch4 T C 17: 34,570,118 Y468H probably damaging Het
Obscn T C 11: 59,067,607 T3507A probably damaging Het
Olfr724 T C 14: 49,960,224 N283D probably damaging Het
Opn5 T C 17: 42,611,296 H5R probably benign Het
Patl1 T C 19: 11,925,151 M349T probably benign Het
Phactr3 A G 2: 178,284,018 N362S probably damaging Het
Pirb C T 7: 3,717,603 G299S probably benign Het
Rapgef5 G A 12: 117,756,074 R579Q probably damaging Het
Rgl1 T C 1: 152,554,330 D234G probably benign Het
Serpinb3a C T 1: 107,048,586 E122K probably benign Het
Slc22a15 T C 3: 101,875,603 probably benign Het
Slc25a12 A T 2: 71,296,805 V344E probably damaging Het
Slc43a2 T C 11: 75,543,293 L99P probably damaging Het
Smim27 G T 4: 40,269,719 probably null Het
Smtn A G 11: 3,520,736 probably benign Het
Szt2 A T 4: 118,369,248 Y3001N unknown Het
Tgfbr3 G T 5: 107,109,719 P825T probably damaging Het
Tnpo3 T C 6: 29,568,938 T472A probably benign Het
Trf T A 9: 103,227,915 D66V probably damaging Het
Vmn1r124 A G 7: 21,259,699 C307R probably damaging Het
Vps13b T A 15: 35,452,224 F656Y possibly damaging Het
Zic1 G T 9: 91,362,531 S358R probably damaging Het
Other mutations in Myoz1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01886:Myoz1 APN 14 20655309 missense probably damaging 0.98
R0081:Myoz1 UTSW 14 20649554 missense probably benign 0.08
R0826:Myoz1 UTSW 14 20653611 splice site probably benign
R0893:Myoz1 UTSW 14 20651184 missense probably benign 0.16
R1029:Myoz1 UTSW 14 20650532 missense probably damaging 1.00
R3078:Myoz1 UTSW 14 20653617 splice site probably benign
R4584:Myoz1 UTSW 14 20650595 missense probably damaging 1.00
R4585:Myoz1 UTSW 14 20650595 missense probably damaging 1.00
R4586:Myoz1 UTSW 14 20650595 missense probably damaging 1.00
R4912:Myoz1 UTSW 14 20649538 missense probably damaging 1.00
R5001:Myoz1 UTSW 14 20653701 missense probably damaging 0.99
R5015:Myoz1 UTSW 14 20653719 missense probably benign 0.42
R5120:Myoz1 UTSW 14 20650654 missense probably benign 0.00
R6682:Myoz1 UTSW 14 20653619 splice site probably null
Predicted Primers PCR Primer
(F):5'- ACCCTCTACAGCTGCAATTC -3'
(R):5'- AGACTGTGACAGTTTACGTTCTG -3'

Sequencing Primer
(F):5'- TCTACAGCTGCAATTCCTCTTG -3'
(R):5'- TCTGTAAAGACGTATGCATGCG -3'
Posted On2016-03-01