Incidental Mutation 'R4831:Cdh10'
ID372845
Institutional Source Beutler Lab
Gene Symbol Cdh10
Ensembl Gene ENSMUSG00000022321
Gene Namecadherin 10
SynonymsT2-cadherin, C030003B10Rik, C030011H18Rik, A830016G23Rik
MMRRC Submission 042447-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.072) question?
Stock #R4831 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location18818947-19014236 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 19013578 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 755 (T755S)
Ref Sequence ENSEMBL: ENSMUSP00000128782 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040562] [ENSMUST00000166873] [ENSMUST00000176146]
Predicted Effect probably benign
Transcript: ENSMUST00000040562
AA Change: T755S

PolyPhen 2 Score 0.103 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000042199
Gene: ENSMUSG00000022321
AA Change: T755S

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
CA 77 158 2.8e-14 SMART
CA 182 267 1.03e-30 SMART
CA 291 383 6.04e-19 SMART
CA 406 487 6.23e-21 SMART
CA 510 594 3.56e-7 SMART
transmembrane domain 612 634 N/A INTRINSIC
Pfam:Cadherin_C 635 782 9.2e-58 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000166873
AA Change: T755S

PolyPhen 2 Score 0.103 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000128782
Gene: ENSMUSG00000022321
AA Change: T755S

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
CA 77 158 2.8e-14 SMART
CA 182 267 1.03e-30 SMART
CA 291 383 6.04e-19 SMART
CA 406 487 6.23e-21 SMART
CA 510 594 3.56e-7 SMART
transmembrane domain 612 634 N/A INTRINSIC
Pfam:Cadherin_C 637 783 1.1e-54 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000176146
SMART Domains Protein: ENSMUSP00000135546
Gene: ENSMUSG00000022321

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
CA 77 158 2.8e-14 SMART
CA 182 267 1.03e-30 SMART
CA 291 383 6.04e-19 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176409
Meta Mutation Damage Score 0.01 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.3%
Validation Efficiency 99% (96/97)
MGI Phenotype FUNCTION: This gene encodes a member of the cadherin family of calcium-dependent glycoproteins that mediate cell adhesion and regulate many morphogenetic events during development. The encoded preproprotein is further processed to generate a mature protein. This gene is expressed in the blood-brain barrier and retinal endothelia suggesting a role in the development and maintenance of brain barrier. Alternative splicing results in multiple transcript variants. Multiple distinct genes of the cadherin family, including this gene, are found on chromosome 15. [provided by RefSeq, Oct 2015]
Allele List at MGI
Other mutations in this stock
Total: 92 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810408A11Rik C T 11: 69,900,577 V59I possibly damaging Het
4930544M13Rik T G 13: 114,607,647 noncoding transcript Het
Abca13 A T 11: 9,542,077 K4373* probably null Het
Abtb2 A T 2: 103,683,475 T410S probably benign Het
Adamts13 T C 2: 26,983,130 probably null Het
Ahnak2 C G 12: 112,775,749 D630H probably damaging Het
Aox3 T C 1: 58,152,566 S426P probably damaging Het
Armc4 G T 18: 7,222,564 H568Q possibly damaging Het
Atxn10 C T 15: 85,387,059 S266F probably benign Het
B4galnt4 T A 7: 141,064,557 probably null Het
B4galnt4 G T 7: 141,067,721 M407I probably damaging Het
Bclaf1 T A 10: 20,322,126 probably benign Het
C4b C T 17: 34,736,890 probably null Het
Cdc42bpg T C 19: 6,311,335 F297S probably damaging Het
Ceacam12 T A 7: 18,077,380 probably null Het
Cfap65 C A 1: 74,917,295 V1042F possibly damaging Het
Cfap77 T C 2: 28,985,832 I89V probably benign Het
Cfh T C 1: 140,086,387 D688G probably benign Het
Clip1 C G 5: 123,583,601 A1182P probably damaging Het
Cyp2b10 T A 7: 25,915,496 Y309* probably null Het
Dcaf5 T C 12: 80,339,084 E756G probably benign Het
Dctn1 A T 6: 83,199,771 Q1231L possibly damaging Het
Dennd1c T A 17: 57,066,428 R682* probably null Het
Eml6 C A 11: 29,777,052 E1319* probably null Het
Erap1 T C 13: 74,690,647 I904T probably damaging Het
Eri1 A T 8: 35,476,519 I207N possibly damaging Het
Farp1 G A 14: 121,277,057 A933T probably damaging Het
Fcna T A 2: 25,625,341 Q210L probably benign Het
Fhad1 A T 4: 141,916,067 probably null Het
Fut8 T G 12: 77,393,829 Y197D probably damaging Het
Garem1 G A 18: 21,129,768 T663I probably benign Het
Gfm2 T C 13: 97,165,038 S450P probably damaging Het
Gstk1 T G 6: 42,246,004 probably benign Het
Helz2 C T 2: 181,237,417 A803T probably damaging Het
Igsf9 T A 1: 172,491,888 I280N probably damaging Het
Klhl10 A G 11: 100,445,843 K219E probably benign Het
L3mbtl4 T A 17: 68,461,563 V222D probably damaging Het
Lrrc9 A T 12: 72,499,679 N1214Y probably damaging Het
Ltbp2 C T 12: 84,793,640 E1051K possibly damaging Het
Mettl17 T C 14: 51,884,983 F13S probably benign Het
Mettl24 C A 10: 40,683,417 A21D possibly damaging Het
Mfsd6l T A 11: 68,556,505 C61S probably benign Het
Mob4 T G 1: 55,152,740 D204E probably benign Het
Mtus1 C G 8: 41,083,152 R509T probably damaging Het
Nlrp4a T A 7: 26,450,419 F484I possibly damaging Het
Nsrp1 T C 11: 77,050,618 N88S probably benign Het
Olfr117 T A 17: 37,660,078 H85L probably benign Het
Olfr623 T C 7: 103,660,471 T260A probably benign Het
Olfr791 T A 10: 129,526,580 Y118N probably damaging Het
Olfr975 C T 9: 39,950,112 V220I probably benign Het
Parg A G 14: 32,202,451 N69S probably benign Het
Pcdh9 A C 14: 93,887,941 N264K probably damaging Het
Pcdhb22 G T 18: 37,520,562 L694F probably damaging Het
Pcnt T C 10: 76,412,501 E928G probably damaging Het
Pdzk1 G A 3: 96,868,435 G373D probably benign Het
Pea15a A G 1: 172,199,173 I89T probably damaging Het
Phc1 T A 6: 122,337,005 probably benign Het
Pikfyve T A 1: 65,196,741 C191S probably damaging Het
Pitpnm1 T A 19: 4,108,130 D573E probably damaging Het
Pld5 A G 1: 176,274,884 probably benign Het
Plscr2 A T 9: 92,291,077 N89I possibly damaging Het
Pm20d2 A C 4: 33,179,293 N315K probably damaging Het
Pnpla1 T A 17: 28,878,544 M228K probably benign Het
Prim2 T C 1: 33,670,136 probably benign Het
Ralgapa2 A G 2: 146,405,067 probably benign Het
Rgs22 G T 15: 36,050,148 H719N probably benign Het
Ror2 C T 13: 53,118,844 D250N probably damaging Het
Saal1 A G 7: 46,699,647 V281A probably benign Het
Selenof A T 3: 144,590,650 K94N probably damaging Het
Slamf9 T A 1: 172,477,264 C148* probably null Het
Slc4a7 T C 14: 14,772,699 probably null Het
Slco1a5 A G 6: 142,234,705 I657T probably benign Het
St3gal2 A T 8: 110,957,848 H46L probably benign Het
Sucnr1 T G 3: 60,086,648 M199R probably damaging Het
Taok1 T A 11: 77,553,674 E525V probably null Het
Tbc1d10c T A 19: 4,185,446 E298V probably damaging Het
Tll2 T A 19: 41,130,512 H259L probably damaging Het
Tpcn1 A T 5: 120,553,489 F300Y probably damaging Het
Uba6 T A 5: 86,131,338 I642L probably benign Het
Ubqln5 T A 7: 104,129,622 probably benign Het
Vmn1r27 A T 6: 58,215,842 L9Q possibly damaging Het
Vmn2r100 C T 17: 19,521,410 T128I probably benign Het
Vmn2r109 C T 17: 20,541,232 G621D probably benign Het
Vmn2r49 C T 7: 9,986,425 D380N probably benign Het
Vps13a C T 19: 16,677,992 V1891I probably benign Het
Wbp2 G T 11: 116,080,637 Y147* probably null Het
Wdr46 T A 17: 33,941,836 N191K probably benign Het
Wdr46 T C 17: 33,949,399 probably benign Het
Wnt2 A C 6: 18,023,286 F121L probably benign Het
Xpnpep1 T A 19: 53,014,622 D100V probably benign Het
Xpo4 T C 14: 57,590,102 Y879C probably damaging Het
Zswim4 A T 8: 84,212,319 V978D probably damaging Het
Other mutations in Cdh10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00475:Cdh10 APN 15 19013263 missense probably damaging 1.00
IGL00540:Cdh10 APN 15 18963995 missense probably damaging 1.00
IGL00769:Cdh10 APN 15 18985099 missense possibly damaging 0.63
IGL00837:Cdh10 APN 15 19013404 missense probably benign
IGL01307:Cdh10 APN 15 18899800 missense probably benign 0.34
IGL01509:Cdh10 APN 15 18986798 missense possibly damaging 0.70
IGL01561:Cdh10 APN 15 18999926 missense possibly damaging 0.52
IGL01743:Cdh10 APN 15 18986769 missense probably benign 0.06
IGL02065:Cdh10 APN 15 19013256 missense probably damaging 1.00
IGL02083:Cdh10 APN 15 18986889 missense possibly damaging 0.79
IGL02238:Cdh10 APN 15 19013519 missense probably damaging 1.00
IGL02838:Cdh10 APN 15 18899763 missense probably damaging 1.00
IGL03397:Cdh10 APN 15 18964028 missense probably damaging 1.00
R0423:Cdh10 UTSW 15 18986879 missense probably benign 0.00
R0828:Cdh10 UTSW 15 18986751 missense possibly damaging 0.52
R1488:Cdh10 UTSW 15 19013263 missense probably damaging 1.00
R1563:Cdh10 UTSW 15 18986767 nonsense probably null
R1674:Cdh10 UTSW 15 18985066 missense probably benign 0.11
R1674:Cdh10 UTSW 15 19013330 missense probably damaging 1.00
R1737:Cdh10 UTSW 15 18964063 missense probably damaging 1.00
R1819:Cdh10 UTSW 15 18991965 nonsense probably null
R1865:Cdh10 UTSW 15 18899604 missense probably benign 0.01
R1953:Cdh10 UTSW 15 18966911 critical splice donor site probably null
R2439:Cdh10 UTSW 15 19013398 missense probably damaging 1.00
R3944:Cdh10 UTSW 15 18964249 missense probably benign
R4320:Cdh10 UTSW 15 18985165 missense probably benign 0.03
R4330:Cdh10 UTSW 15 18999959 missense probably damaging 1.00
R4765:Cdh10 UTSW 15 19013278 missense probably damaging 0.98
R5102:Cdh10 UTSW 15 18986885 missense probably benign 0.05
R5166:Cdh10 UTSW 15 19013360 missense probably damaging 0.99
R5217:Cdh10 UTSW 15 18966022 missense probably damaging 0.98
R5843:Cdh10 UTSW 15 18985200 missense possibly damaging 0.68
R5902:Cdh10 UTSW 15 18985255 critical splice donor site probably null
R6263:Cdh10 UTSW 15 18964068 missense possibly damaging 0.86
R6636:Cdh10 UTSW 15 18985173 missense probably damaging 0.99
R6770:Cdh10 UTSW 15 18985222 missense probably benign 0.09
R7046:Cdh10 UTSW 15 19013201 missense probably damaging 0.98
R7362:Cdh10 UTSW 15 18899694 missense probably benign
R7491:Cdh10 UTSW 15 19013359 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGAGGAACCCTGCAGCTATC -3'
(R):5'- TGTGAAGTGGAGACAGTGTC -3'

Sequencing Primer
(F):5'- AGCTCCGGCGAGATATAATTCCTG -3'
(R):5'- GACAGTGTCCGCAAAGTTAAC -3'
Posted On2016-03-01