Incidental Mutation 'R4831:Vmn2r100'
ID372848
Institutional Source Beutler Lab
Gene Symbol Vmn2r100
Ensembl Gene ENSMUSG00000091859
Gene Namevomeronasal 2, receptor 100
SynonymsEG627537
MMRRC Submission 042447-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.087) question?
Stock #R4831 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location19504732-19535231 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 19521410 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 128 (T128I)
Ref Sequence ENSEMBL: ENSMUSP00000128350 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000166081] [ENSMUST00000231465]
Predicted Effect probably benign
Transcript: ENSMUST00000166081
AA Change: T128I

PolyPhen 2 Score 0.283 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000128350
Gene: ENSMUSG00000091859
AA Change: T128I

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:ANF_receptor 83 456 7.4e-41 PFAM
Pfam:NCD3G 510 563 1.9e-21 PFAM
Pfam:7tm_3 594 831 2.6e-51 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000231465
AA Change: T128I

PolyPhen 2 Score 0.113 (Sensitivity: 0.93; Specificity: 0.86)
Meta Mutation Damage Score 0.1072 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.3%
Validation Efficiency 99% (96/97)
Allele List at MGI
Other mutations in this stock
Total: 92 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810408A11Rik C T 11: 69,900,577 V59I possibly damaging Het
4930544M13Rik T G 13: 114,607,647 noncoding transcript Het
Abca13 A T 11: 9,542,077 K4373* probably null Het
Abtb2 A T 2: 103,683,475 T410S probably benign Het
Adamts13 T C 2: 26,983,130 probably null Het
Ahnak2 C G 12: 112,775,749 D630H probably damaging Het
Aox3 T C 1: 58,152,566 S426P probably damaging Het
Armc4 G T 18: 7,222,564 H568Q possibly damaging Het
Atxn10 C T 15: 85,387,059 S266F probably benign Het
B4galnt4 T A 7: 141,064,557 probably null Het
B4galnt4 G T 7: 141,067,721 M407I probably damaging Het
Bclaf1 T A 10: 20,322,126 probably benign Het
C4b C T 17: 34,736,890 probably null Het
Cdc42bpg T C 19: 6,311,335 F297S probably damaging Het
Cdh10 A T 15: 19,013,578 T755S probably benign Het
Ceacam12 T A 7: 18,077,380 probably null Het
Cfap65 C A 1: 74,917,295 V1042F possibly damaging Het
Cfap77 T C 2: 28,985,832 I89V probably benign Het
Cfh T C 1: 140,086,387 D688G probably benign Het
Clip1 C G 5: 123,583,601 A1182P probably damaging Het
Cyp2b10 T A 7: 25,915,496 Y309* probably null Het
Dcaf5 T C 12: 80,339,084 E756G probably benign Het
Dctn1 A T 6: 83,199,771 Q1231L possibly damaging Het
Dennd1c T A 17: 57,066,428 R682* probably null Het
Eml6 C A 11: 29,777,052 E1319* probably null Het
Erap1 T C 13: 74,690,647 I904T probably damaging Het
Eri1 A T 8: 35,476,519 I207N possibly damaging Het
Farp1 G A 14: 121,277,057 A933T probably damaging Het
Fcna T A 2: 25,625,341 Q210L probably benign Het
Fhad1 A T 4: 141,916,067 probably null Het
Fut8 T G 12: 77,393,829 Y197D probably damaging Het
Garem1 G A 18: 21,129,768 T663I probably benign Het
Gfm2 T C 13: 97,165,038 S450P probably damaging Het
Gstk1 T G 6: 42,246,004 probably benign Het
Helz2 C T 2: 181,237,417 A803T probably damaging Het
Igsf9 T A 1: 172,491,888 I280N probably damaging Het
Klhl10 A G 11: 100,445,843 K219E probably benign Het
L3mbtl4 T A 17: 68,461,563 V222D probably damaging Het
Lrrc9 A T 12: 72,499,679 N1214Y probably damaging Het
Ltbp2 C T 12: 84,793,640 E1051K possibly damaging Het
Mettl17 T C 14: 51,884,983 F13S probably benign Het
Mettl24 C A 10: 40,683,417 A21D possibly damaging Het
Mfsd6l T A 11: 68,556,505 C61S probably benign Het
Mob4 T G 1: 55,152,740 D204E probably benign Het
Mtus1 C G 8: 41,083,152 R509T probably damaging Het
Nlrp4a T A 7: 26,450,419 F484I possibly damaging Het
Nsrp1 T C 11: 77,050,618 N88S probably benign Het
Olfr117 T A 17: 37,660,078 H85L probably benign Het
Olfr623 T C 7: 103,660,471 T260A probably benign Het
Olfr791 T A 10: 129,526,580 Y118N probably damaging Het
Olfr975 C T 9: 39,950,112 V220I probably benign Het
Parg A G 14: 32,202,451 N69S probably benign Het
Pcdh9 A C 14: 93,887,941 N264K probably damaging Het
Pcdhb22 G T 18: 37,520,562 L694F probably damaging Het
Pcnt T C 10: 76,412,501 E928G probably damaging Het
Pdzk1 G A 3: 96,868,435 G373D probably benign Het
Pea15a A G 1: 172,199,173 I89T probably damaging Het
Phc1 T A 6: 122,337,005 probably benign Het
Pikfyve T A 1: 65,196,741 C191S probably damaging Het
Pitpnm1 T A 19: 4,108,130 D573E probably damaging Het
Pld5 A G 1: 176,274,884 probably benign Het
Plscr2 A T 9: 92,291,077 N89I possibly damaging Het
Pm20d2 A C 4: 33,179,293 N315K probably damaging Het
Pnpla1 T A 17: 28,878,544 M228K probably benign Het
Prim2 T C 1: 33,670,136 probably benign Het
Ralgapa2 A G 2: 146,405,067 probably benign Het
Rgs22 G T 15: 36,050,148 H719N probably benign Het
Ror2 C T 13: 53,118,844 D250N probably damaging Het
Saal1 A G 7: 46,699,647 V281A probably benign Het
Selenof A T 3: 144,590,650 K94N probably damaging Het
Slamf9 T A 1: 172,477,264 C148* probably null Het
Slc4a7 T C 14: 14,772,699 probably null Het
Slco1a5 A G 6: 142,234,705 I657T probably benign Het
St3gal2 A T 8: 110,957,848 H46L probably benign Het
Sucnr1 T G 3: 60,086,648 M199R probably damaging Het
Taok1 T A 11: 77,553,674 E525V probably null Het
Tbc1d10c T A 19: 4,185,446 E298V probably damaging Het
Tll2 T A 19: 41,130,512 H259L probably damaging Het
Tpcn1 A T 5: 120,553,489 F300Y probably damaging Het
Uba6 T A 5: 86,131,338 I642L probably benign Het
Ubqln5 T A 7: 104,129,622 probably benign Het
Vmn1r27 A T 6: 58,215,842 L9Q possibly damaging Het
Vmn2r109 C T 17: 20,541,232 G621D probably benign Het
Vmn2r49 C T 7: 9,986,425 D380N probably benign Het
Vps13a C T 19: 16,677,992 V1891I probably benign Het
Wbp2 G T 11: 116,080,637 Y147* probably null Het
Wdr46 T A 17: 33,941,836 N191K probably benign Het
Wdr46 T C 17: 33,949,399 probably benign Het
Wnt2 A C 6: 18,023,286 F121L probably benign Het
Xpnpep1 T A 19: 53,014,622 D100V probably benign Het
Xpo4 T C 14: 57,590,102 Y879C probably damaging Het
Zswim4 A T 8: 84,212,319 V978D probably damaging Het
Other mutations in Vmn2r100
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00904:Vmn2r100 APN 17 19526000 missense probably damaging 1.00
IGL00912:Vmn2r100 APN 17 19531392 missense possibly damaging 0.95
IGL01107:Vmn2r100 APN 17 19521356 missense probably damaging 1.00
IGL01517:Vmn2r100 APN 17 19521963 missense probably benign 0.37
IGL01594:Vmn2r100 APN 17 19531233 missense possibly damaging 0.52
IGL01657:Vmn2r100 APN 17 19525916 missense possibly damaging 0.89
IGL01822:Vmn2r100 APN 17 19504838 missense probably null 0.00
IGL02020:Vmn2r100 APN 17 19504938 missense possibly damaging 0.78
IGL02060:Vmn2r100 APN 17 19521254 missense possibly damaging 0.79
IGL02126:Vmn2r100 APN 17 19521242 splice site probably benign
IGL02142:Vmn2r100 APN 17 19522321 missense probably damaging 1.00
IGL02308:Vmn2r100 APN 17 19521335 missense possibly damaging 0.90
IGL02407:Vmn2r100 APN 17 19521508 missense probably damaging 0.98
IGL02469:Vmn2r100 APN 17 19531285 nonsense probably null
IGL03088:Vmn2r100 APN 17 19522039 missense probably benign 0.27
IGL03181:Vmn2r100 APN 17 19531945 missense probably damaging 1.00
IGL03405:Vmn2r100 APN 17 19531924 missense probably damaging 1.00
H8562:Vmn2r100 UTSW 17 19521490 missense possibly damaging 0.87
R0012:Vmn2r100 UTSW 17 19504874 missense probably benign
R0012:Vmn2r100 UTSW 17 19526034 missense probably damaging 0.99
R0044:Vmn2r100 UTSW 17 19522179 missense possibly damaging 0.46
R0109:Vmn2r100 UTSW 17 19522120 missense possibly damaging 0.80
R0111:Vmn2r100 UTSW 17 19522120 missense possibly damaging 0.80
R0112:Vmn2r100 UTSW 17 19522120 missense possibly damaging 0.80
R0149:Vmn2r100 UTSW 17 19521247 critical splice acceptor site probably null
R0355:Vmn2r100 UTSW 17 19531320 missense probably benign 0.00
R0395:Vmn2r100 UTSW 17 19522120 missense possibly damaging 0.80
R0396:Vmn2r100 UTSW 17 19522120 missense possibly damaging 0.80
R0453:Vmn2r100 UTSW 17 19522120 missense possibly damaging 0.80
R0465:Vmn2r100 UTSW 17 19531530 missense probably damaging 0.98
R0477:Vmn2r100 UTSW 17 19522514 missense probably benign 0.00
R0510:Vmn2r100 UTSW 17 19522120 missense possibly damaging 0.80
R0512:Vmn2r100 UTSW 17 19522120 missense possibly damaging 0.80
R0514:Vmn2r100 UTSW 17 19522120 missense possibly damaging 0.80
R0518:Vmn2r100 UTSW 17 19521916 missense probably damaging 1.00
R0521:Vmn2r100 UTSW 17 19521916 missense probably damaging 1.00
R0555:Vmn2r100 UTSW 17 19522120 missense possibly damaging 0.80
R0608:Vmn2r100 UTSW 17 19522120 missense possibly damaging 0.80
R0959:Vmn2r100 UTSW 17 19523524 missense possibly damaging 0.95
R1114:Vmn2r100 UTSW 17 19531999 missense probably damaging 1.00
R2027:Vmn2r100 UTSW 17 19522072 missense probably benign 0.02
R2049:Vmn2r100 UTSW 17 19522050 missense probably benign 0.00
R2224:Vmn2r100 UTSW 17 19522372 missense probably benign 0.03
R2226:Vmn2r100 UTSW 17 19522372 missense probably benign 0.03
R3618:Vmn2r100 UTSW 17 19523430 missense probably benign
R3715:Vmn2r100 UTSW 17 19532010 missense probably damaging 0.99
R4120:Vmn2r100 UTSW 17 19531953 missense probably damaging 1.00
R4152:Vmn2r100 UTSW 17 19523419 frame shift probably null
R4153:Vmn2r100 UTSW 17 19523419 frame shift probably null
R4154:Vmn2r100 UTSW 17 19523419 frame shift probably null
R4200:Vmn2r100 UTSW 17 19522535 missense probably benign 0.29
R4632:Vmn2r100 UTSW 17 19531954 missense probably damaging 1.00
R4720:Vmn2r100 UTSW 17 19522526 missense probably benign 0.02
R4761:Vmn2r100 UTSW 17 19521368 missense possibly damaging 0.47
R4951:Vmn2r100 UTSW 17 19532038 missense probably benign 0.01
R5211:Vmn2r100 UTSW 17 19525995 missense possibly damaging 0.67
R5553:Vmn2r100 UTSW 17 19504848 missense possibly damaging 0.64
R5657:Vmn2r100 UTSW 17 19504916 missense probably benign 0.31
R5883:Vmn2r100 UTSW 17 19523524 missense probably benign
R5912:Vmn2r100 UTSW 17 19531809 missense probably damaging 0.99
R6141:Vmn2r100 UTSW 17 19522314 missense probably benign 0.07
R6146:Vmn2r100 UTSW 17 19522260 missense probably benign 0.04
R6500:Vmn2r100 UTSW 17 19522093 missense probably damaging 1.00
R6575:Vmn2r100 UTSW 17 19521409 missense probably benign 0.12
R6647:Vmn2r100 UTSW 17 19522523 missense probably benign 0.00
R7038:Vmn2r100 UTSW 17 19505001 missense possibly damaging 0.76
R7052:Vmn2r100 UTSW 17 19531294 missense possibly damaging 0.95
R7170:Vmn2r100 UTSW 17 19531971 missense probably benign 0.00
R7209:Vmn2r100 UTSW 17 19531314 missense not run
R7312:Vmn2r100 UTSW 17 19522034 missense probably benign 0.01
X0062:Vmn2r100 UTSW 17 19531390 missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- TGCCACGTACACAGGTATAAC -3'
(R):5'- AATCTGGACTGAATTGTATGGGTCTC -3'

Sequencing Primer
(F):5'- GCCACGTACACAGGTATAACTTTAAG -3'
(R):5'- TGTGTGGATAATTGATCAATCACTC -3'
Posted On2016-03-01