Incidental Mutation 'R4832:Abcc9'
ID372901
Institutional Source Beutler Lab
Gene Symbol Abcc9
Ensembl Gene ENSMUSG00000030249
Gene NameATP-binding cassette, sub-family C (CFTR/MRP), member 9
SynonymsSUR2B, Sur2, SUR2A
MMRRC Submission 042448-MU
Accession Numbers

Ncbi RefSeq: NM_001044720.1; MGI: 1352630

Is this an essential gene? Probably non essential (E-score: 0.228) question?
Stock #R4832 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location142587862-142702315 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 142671556 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 594 (V594A)
Ref Sequence ENSEMBL: ENSMUSP00000144779 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073173] [ENSMUST00000087527] [ENSMUST00000100827] [ENSMUST00000111771] [ENSMUST00000205202]
Predicted Effect probably damaging
Transcript: ENSMUST00000073173
AA Change: V594A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000072914
Gene: ENSMUSG00000030249
AA Change: V594A

DomainStartEndE-ValueType
transmembrane domain 28 50 N/A INTRINSIC
transmembrane domain 71 93 N/A INTRINSIC
transmembrane domain 103 125 N/A INTRINSIC
transmembrane domain 137 159 N/A INTRINSIC
transmembrane domain 169 188 N/A INTRINSIC
low complexity region 265 276 N/A INTRINSIC
Pfam:ABC_membrane 297 583 7.7e-33 PFAM
AAA 659 867 3.11e-13 SMART
coiled coil region 881 935 N/A INTRINSIC
Pfam:ABC_membrane 956 1228 6.6e-35 PFAM
AAA 1300 1502 9.94e-12 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000087527
AA Change: V594A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000084805
Gene: ENSMUSG00000030249
AA Change: V594A

DomainStartEndE-ValueType
transmembrane domain 28 50 N/A INTRINSIC
transmembrane domain 71 93 N/A INTRINSIC
transmembrane domain 103 125 N/A INTRINSIC
transmembrane domain 137 159 N/A INTRINSIC
transmembrane domain 169 188 N/A INTRINSIC
low complexity region 265 276 N/A INTRINSIC
Pfam:ABC_membrane 297 583 8e-33 PFAM
AAA 694 902 3.11e-13 SMART
coiled coil region 916 970 N/A INTRINSIC
Pfam:ABC_membrane 991 1263 6.8e-35 PFAM
AAA 1335 1537 9.94e-12 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000100827
AA Change: V594A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000098390
Gene: ENSMUSG00000030249
AA Change: V594A

DomainStartEndE-ValueType
transmembrane domain 28 50 N/A INTRINSIC
transmembrane domain 71 93 N/A INTRINSIC
transmembrane domain 103 125 N/A INTRINSIC
transmembrane domain 137 159 N/A INTRINSIC
transmembrane domain 169 188 N/A INTRINSIC
low complexity region 265 276 N/A INTRINSIC
Pfam:ABC_membrane 297 583 7.1e-35 PFAM
AAA 694 902 3.11e-13 SMART
coiled coil region 916 970 N/A INTRINSIC
Pfam:ABC_membrane 991 1263 5.2e-38 PFAM
AAA 1335 1520 5.13e-14 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000111771
AA Change: V594A

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000107401
Gene: ENSMUSG00000030249
AA Change: V594A

DomainStartEndE-ValueType
transmembrane domain 28 50 N/A INTRINSIC
transmembrane domain 71 93 N/A INTRINSIC
transmembrane domain 103 125 N/A INTRINSIC
transmembrane domain 137 159 N/A INTRINSIC
transmembrane domain 169 188 N/A INTRINSIC
low complexity region 265 276 N/A INTRINSIC
Pfam:ABC_membrane 297 583 1.4e-32 PFAM
AAA 694 889 3.77e-12 SMART
coiled coil region 903 957 N/A INTRINSIC
Pfam:ABC_membrane 978 1250 1.2e-34 PFAM
AAA 1322 1524 9.94e-12 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000205202
AA Change: V594A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000144779
Gene: ENSMUSG00000030249
AA Change: V594A

DomainStartEndE-ValueType
transmembrane domain 28 50 N/A INTRINSIC
transmembrane domain 71 93 N/A INTRINSIC
transmembrane domain 103 125 N/A INTRINSIC
transmembrane domain 137 159 N/A INTRINSIC
transmembrane domain 169 188 N/A INTRINSIC
low complexity region 265 276 N/A INTRINSIC
Pfam:ABC_membrane 297 583 6.9e-35 PFAM
AAA 659 867 3.11e-13 SMART
coiled coil region 881 935 N/A INTRINSIC
Pfam:ABC_membrane 956 1228 5e-38 PFAM
AAA 1300 1502 9.94e-12 SMART
Meta Mutation Damage Score 0.348 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.9%
Validation Efficiency 98% (106/108)
MGI Phenotype Strain: 2155916
Lethality: D42-D210
FUNCTION: The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the MRP subfamily which is involved in multi-drug resistance. The human protein is thought to form ATP-sensitive potassium channels in cardiac, skeletal, and vascular and non-vascular smooth muscle. Protein structure suggests a role as the drug-binding channel-modulating subunit of the extrapancreatic ATP-sensitive potassium channels. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Jul 2015]
PHENOTYPE: Mice homozygous for a null allele display lower serum glucose, enhanced insulin action, growth retardation, hypertension and spontaneous death due to episodic coronary artery vasospasm. Homozygous exon 5 deletion leads to cardiac mitochondrial defects, cardiomyopathy, and early postnatal death. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Targeted(4)

Other mutations in this stock
Total: 98 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110032F04Rik T C 3: 68,870,264 V186A possibly damaging Het
1700088E04Rik A T 15: 79,135,209 M198K probably damaging Het
4931406P16Rik T C 7: 34,238,908 probably benign Het
4933402J07Rik A G 8: 87,567,973 K84R probably null Het
9930021J03Rik G T 19: 29,717,216 L1626I possibly damaging Het
A530099J19Rik T A 13: 19,729,670 noncoding transcript Het
Aamdc T C 7: 97,550,566 probably null Het
Adamts13 G A 2: 26,989,402 D656N probably benign Het
Adcy10 G T 1: 165,506,644 C122F probably damaging Het
Adi1 A G 12: 28,675,253 M1V probably null Het
Ahnak G A 19: 9,012,460 probably benign Het
Akt1 G T 12: 112,657,087 P313Q probably damaging Het
Ano3 A T 2: 110,667,722 M758K probably damaging Het
Baz2a T A 10: 128,123,130 N1168K probably benign Het
Bbs10 A G 10: 111,301,134 K703E probably benign Het
Bcap29 A G 12: 31,624,203 I131T probably benign Het
Btnl6 T C 17: 34,513,992 D299G possibly damaging Het
Ccdc66 A G 14: 27,500,567 I73T probably benign Het
Cdh2 A G 18: 16,627,697 S538P probably benign Het
Cfap54 T A 10: 92,967,528 M1551L probably benign Het
Chd2 G A 7: 73,502,125 A243V probably damaging Het
Cntnap1 T A 11: 101,183,019 N665K probably damaging Het
Colgalt2 C T 1: 152,484,998 T262I possibly damaging Het
Cyp24a1 T C 2: 170,496,178 I149V probably benign Het
Cyp2a5 T A 7: 26,835,545 probably null Het
Dab2 A G 15: 6,336,599 probably null Het
Dnah17 T A 11: 118,026,780 I4158F probably damaging Het
Dnm2 G A 9: 21,474,679 probably null Het
Dpp7 A T 2: 25,352,386 probably benign Het
Epha6 T A 16: 59,960,413 I642F probably damaging Het
Erbb4 T C 1: 68,330,238 S415G probably benign Het
Fancd2 A G 6: 113,553,722 T439A probably benign Het
Fat1 G A 8: 45,013,065 V1431M possibly damaging Het
Fhod3 G A 18: 25,090,248 A884T probably benign Het
Fsip2 A G 2: 82,990,171 D5416G possibly damaging Het
Gabarap C T 11: 69,991,852 probably benign Het
Gm11544 C T 11: 94,845,706 noncoding transcript Het
Gnat2 A C 3: 108,100,648 K304Q probably benign Het
Gramd4 C T 15: 86,134,856 A575V probably benign Het
Gtpbp10 G A 5: 5,539,295 A274V possibly damaging Het
Gzmb A G 14: 56,260,222 I187T probably damaging Het
H2-M10.2 G A 17: 36,284,327 T315I probably damaging Het
Haus5 A T 7: 30,657,027 F524I probably damaging Het
Herc1 A G 9: 66,495,971 S4391G probably benign Het
Herc2 T A 7: 56,098,417 L511* probably null Het
Htt T A 5: 34,824,840 C923S probably benign Het
Idua T C 5: 108,669,381 S7P probably benign Het
Ighv16-1 A T 12: 114,068,846 L112Q probably damaging Het
Igkv1-110 A G 6: 68,271,201 K98R probably benign Het
Kif15 G A 9: 123,002,126 probably null Het
Leng9 C A 7: 4,149,030 G216W probably damaging Het
Lrpprc A G 17: 84,707,156 L1306S probably benign Het
Lztfl1 C A 9: 123,715,389 E20D possibly damaging Het
Maob T C X: 16,716,423 T400A probably benign Het
Map3k4 C T 17: 12,271,780 E255K probably damaging Het
Megf9 G A 4: 70,534,428 T132M probably damaging Het
Mob4 T C 1: 55,145,252 probably benign Het
Mttp G A 3: 138,116,050 A252V probably benign Het
Mxi1 A G 19: 53,370,314 D226G probably damaging Het
Myh14 A G 7: 44,625,142 S1249P probably benign Het
Mylk G A 16: 34,922,367 G1083D probably benign Het
Mylk4 T G 13: 32,721,977 I408L probably benign Het
Nbas A G 12: 13,483,739 S1792G probably benign Het
Nelfb A G 2: 25,209,969 V212A probably damaging Het
Nisch T C 14: 31,177,630 probably benign Het
Nqo1 C G 8: 107,388,845 D267H probably benign Het
Olfr1037 C A 2: 86,084,846 L310F probably benign Het
Pcid2 T A 8: 13,085,425 I195F probably damaging Het
Pcnx2 A T 8: 125,752,188 M2107K probably damaging Het
Pgd A T 4: 149,156,591 probably benign Het
Prim2 T C 1: 33,464,064 M430V probably benign Het
Prkaa1 A G 15: 5,160,620 T40A probably damaging Het
Ptges T C 2: 30,903,220 probably benign Het
Ptprn T C 1: 75,258,265 E226G probably benign Het
Rab14 A G 2: 35,189,966 F55S probably damaging Het
Ralgps2 A T 1: 156,857,067 probably benign Het
Rgs11 C T 17: 26,207,568 H258Y probably benign Het
Rhpn2 T C 7: 35,376,349 probably null Het
Rprd2 A T 3: 95,774,171 V452E probably damaging Het
Scube3 C A 17: 28,166,015 H646Q probably damaging Het
Selp A T 1: 164,126,340 I70F probably damaging Het
Sept2 A G 1: 93,499,127 I153V probably damaging Het
Sh3rf3 G A 10: 58,814,083 S170N probably benign Het
Skint4 A T 4: 112,143,766 I353F possibly damaging Het
Slc16a12 A G 19: 34,680,380 I41T possibly damaging Het
Snai2 T C 16: 14,707,017 F129S probably damaging Het
Top3b C T 16: 16,890,662 R629* probably null Het
Trim17 T A 11: 58,971,444 V434E probably damaging Het
Ttn G A 2: 76,784,983 P15051L probably damaging Het
Uggt2 A T 14: 119,001,847 I1391N probably damaging Het
Usp8 A T 2: 126,755,038 M923L probably damaging Het
Vmn1r176 T C 7: 23,835,038 H230R possibly damaging Het
Vmn1r217 C A 13: 23,113,989 D248Y probably damaging Het
Vmn2r14 A T 5: 109,216,110 C647S probably damaging Het
Vwa5b1 A G 4: 138,605,540 I237T probably damaging Het
Zan T A 5: 137,393,161 D4687V unknown Het
Zfp273 T C 13: 67,825,365 V204A probably benign Het
Zfp956 T G 6: 47,952,053 probably benign Het
Other mutations in Abcc9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Abcc9 APN 6 142633190 splice site probably benign
IGL00670:Abcc9 APN 6 142687281 missense probably damaging 1.00
IGL00675:Abcc9 APN 6 142664621 missense probably damaging 1.00
IGL00741:Abcc9 APN 6 142687230 missense probably benign
IGL01371:Abcc9 APN 6 142656614 missense probably benign 0.04
IGL01686:Abcc9 APN 6 142603075 missense possibly damaging 0.71
IGL01724:Abcc9 APN 6 142664533 missense probably benign 0.00
IGL01807:Abcc9 APN 6 142605914 missense probably damaging 1.00
IGL01941:Abcc9 APN 6 142605904 missense probably damaging 1.00
IGL01946:Abcc9 APN 6 142626037 missense probably benign 0.16
IGL02210:Abcc9 APN 6 142687371 missense probably damaging 1.00
IGL02498:Abcc9 APN 6 142671539 critical splice donor site probably null
IGL02535:Abcc9 APN 6 142628426 missense probably benign 0.00
IGL02552:Abcc9 APN 6 142605919 missense possibly damaging 0.94
IGL02812:Abcc9 APN 6 142697790 missense possibly damaging 0.77
IGL02954:Abcc9 APN 6 142646281 missense probably damaging 0.97
IGL03035:Abcc9 APN 6 142627593 missense probably damaging 1.00
IGL03040:Abcc9 APN 6 142652597 nonsense probably null
IGL03100:Abcc9 APN 6 142694544 missense probably damaging 1.00
IGL03157:Abcc9 APN 6 142605923 splice site probably benign
R0054:Abcc9 UTSW 6 142601774 critical splice donor site probably null
R0054:Abcc9 UTSW 6 142601774 critical splice donor site probably null
R0084:Abcc9 UTSW 6 142658551 missense probably damaging 0.97
R0211:Abcc9 UTSW 6 142688984 missense probably benign 0.01
R0349:Abcc9 UTSW 6 142664625 missense probably benign 0.00
R0387:Abcc9 UTSW 6 142639504 nonsense probably null
R0393:Abcc9 UTSW 6 142645878 splice site probably benign
R0528:Abcc9 UTSW 6 142692880 missense probably damaging 1.00
R0588:Abcc9 UTSW 6 142603061 nonsense probably null
R0646:Abcc9 UTSW 6 142682104 missense probably benign 0.05
R0691:Abcc9 UTSW 6 142639253 missense possibly damaging 0.94
R0881:Abcc9 UTSW 6 142646303 missense probably damaging 1.00
R1264:Abcc9 UTSW 6 142646377 splice site probably benign
R1340:Abcc9 UTSW 6 142682855 splice site probably benign
R1413:Abcc9 UTSW 6 142590496 missense probably damaging 1.00
R1413:Abcc9 UTSW 6 142627519 missense possibly damaging 0.65
R1535:Abcc9 UTSW 6 142664635 missense probably damaging 1.00
R1595:Abcc9 UTSW 6 142633095 missense probably benign 0.02
R1670:Abcc9 UTSW 6 142594722 missense possibly damaging 0.89
R1769:Abcc9 UTSW 6 142627468 splice site probably benign
R1888:Abcc9 UTSW 6 142679314 missense probably benign
R1888:Abcc9 UTSW 6 142679314 missense probably benign
R1918:Abcc9 UTSW 6 142697682 missense probably damaging 1.00
R1925:Abcc9 UTSW 6 142671607 missense probably damaging 0.98
R2019:Abcc9 UTSW 6 142675434 missense probably damaging 1.00
R2698:Abcc9 UTSW 6 142633136 missense possibly damaging 0.93
R2860:Abcc9 UTSW 6 142626010 missense probably benign 0.01
R2861:Abcc9 UTSW 6 142626010 missense probably benign 0.01
R2980:Abcc9 UTSW 6 142687308 missense probably benign 0.00
R3115:Abcc9 UTSW 6 142689029 missense probably benign 0.08
R3617:Abcc9 UTSW 6 142679289 missense probably damaging 0.97
R3880:Abcc9 UTSW 6 142639233 missense probably damaging 1.00
R4063:Abcc9 UTSW 6 142605919 missense possibly damaging 0.94
R4065:Abcc9 UTSW 6 142645890 missense probably damaging 1.00
R4290:Abcc9 UTSW 6 142594012 missense probably benign 0.08
R4538:Abcc9 UTSW 6 142614412 critical splice donor site probably null
R4615:Abcc9 UTSW 6 142689107 missense possibly damaging 0.93
R4659:Abcc9 UTSW 6 142672595 splice site probably null
R4774:Abcc9 UTSW 6 142639317 missense probably damaging 1.00
R4788:Abcc9 UTSW 6 142620730 nonsense probably null
R4844:Abcc9 UTSW 6 142689098 missense probably benign 0.09
R4903:Abcc9 UTSW 6 142600965 missense probably damaging 1.00
R4921:Abcc9 UTSW 6 142590436 missense probably benign
R4960:Abcc9 UTSW 6 142620783 splice site probably null
R4983:Abcc9 UTSW 6 142682141 missense probably benign 0.44
R4986:Abcc9 UTSW 6 142627591 missense probably benign 0.00
R5060:Abcc9 UTSW 6 142626110 intron probably benign
R5120:Abcc9 UTSW 6 142656618 missense probably benign 0.00
R5198:Abcc9 UTSW 6 142626000 missense probably benign 0.00
R5301:Abcc9 UTSW 6 142590481 missense probably benign 0.41
R5328:Abcc9 UTSW 6 142682059 missense probably benign 0.25
R5568:Abcc9 UTSW 6 142689016 missense possibly damaging 0.62
R5654:Abcc9 UTSW 6 142625645 intron probably benign
R5694:Abcc9 UTSW 6 142600947 missense probably damaging 1.00
R5734:Abcc9 UTSW 6 142625731 intron probably benign
R5774:Abcc9 UTSW 6 142628559 missense probably damaging 0.98
R5802:Abcc9 UTSW 6 142656676 critical splice acceptor site probably null
R5890:Abcc9 UTSW 6 142604828 critical splice donor site probably null
R5946:Abcc9 UTSW 6 142625952 missense probably damaging 1.00
R5971:Abcc9 UTSW 6 142639575 missense probably damaging 1.00
R6078:Abcc9 UTSW 6 142639575 missense probably damaging 1.00
R6392:Abcc9 UTSW 6 142682099 missense probably damaging 1.00
R6400:Abcc9 UTSW 6 142692709 makesense probably null
R6478:Abcc9 UTSW 6 142679308 missense probably damaging 1.00
R6481:Abcc9 UTSW 6 142604895 missense probably damaging 0.99
R6564:Abcc9 UTSW 6 142603108 missense probably damaging 1.00
R6700:Abcc9 UTSW 6 142687287 missense possibly damaging 0.94
R6902:Abcc9 UTSW 6 142679227 missense probably damaging 1.00
R6946:Abcc9 UTSW 6 142679227 missense probably damaging 1.00
R6989:Abcc9 UTSW 6 142688981 missense probably damaging 0.97
R7052:Abcc9 UTSW 6 142658535 missense probably benign 0.00
R7062:Abcc9 UTSW 6 142599146 missense probably damaging 1.00
R7121:Abcc9 UTSW 6 142689127 nonsense probably null
U15987:Abcc9 UTSW 6 142639575 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTAACAGTGGGAATCTTTGCAC -3'
(R):5'- GCACAGTAGGATTCGCTAGG -3'

Sequencing Primer
(F):5'- GTGGGAATCTTTGCACATCATTTTC -3'
(R):5'- AGTTGAGTGTCAGCATGCATACC -3'
Posted On2016-03-01