Incidental Mutation 'R4833:1810055G02Rik'
List |< first << previous [record 57 of 18487] next >> last >|
ID373024
Institutional Source Beutler Lab
Gene Symbol 1810055G02Rik
Ensembl Gene ENSMUSG00000035372
Gene NameRIKEN cDNA 1810055G02 gene
Synonyms
MMRRC Submission 042449-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.071) question?
Stock #R4833 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location3708333-3717881 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 3716872 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Lysine at position 153 (T153K)
Ref Sequence ENSEMBL: ENSMUSP00000047063 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039048]
Predicted Effect possibly damaging
Transcript: ENSMUST00000039048
AA Change: T153K

PolyPhen 2 Score 0.869 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000047063
Gene: ENSMUSG00000035372
AA Change: T153K

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
low complexity region 86 97 N/A INTRINSIC
low complexity region 265 288 N/A INTRINSIC
low complexity region 292 310 N/A INTRINSIC
transmembrane domain 343 365 N/A INTRINSIC
Meta Mutation Damage Score 0.118 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.8%
Validation Efficiency 99% (74/75)
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik A G 3: 36,964,968 I2007V probably damaging Het
Abca5 A C 11: 110,279,316 Y1318D probably benign Het
Adam18 A G 8: 24,674,101 I22T probably benign Het
Adgrv1 T A 13: 81,560,844 H1147L possibly damaging Het
Ankrd2 T C 19: 42,043,857 probably null Het
Bdkrb2 T C 12: 105,591,658 W53R probably benign Het
Blm T A 7: 80,466,826 I1111L probably benign Het
Bmp3 T G 5: 98,855,207 L32R probably damaging Het
Cdh23 T G 10: 60,385,038 E1312A probably damaging Het
Ceacam5 C T 7: 17,752,258 T560M probably benign Het
Cmtm8 C A 9: 114,796,165 R66I probably benign Het
Cnbd1 A G 4: 18,862,120 Y357H probably damaging Het
Col4a4 A T 1: 82,529,602 V252E unknown Het
Col6a4 A T 9: 106,071,979 M819K probably benign Het
Cwf19l2 T C 9: 3,430,783 S372P probably benign Het
Daam2 A T 17: 49,490,145 I204N possibly damaging Het
Dock6 T C 9: 21,844,280 D216G probably damaging Het
Epha5 C T 5: 84,105,891 D548N possibly damaging Het
Erich2 T C 2: 70,534,292 Y311H possibly damaging Het
Gm3985 A G 8: 32,890,477 noncoding transcript Het
Gnb1 A G 4: 155,543,067 T102A possibly damaging Het
Hcfc2 C T 10: 82,709,146 A204V probably null Het
Hnrnpu T C 1: 178,333,894 probably benign Het
Htt A G 5: 34,852,225 T1517A probably damaging Het
Klhl6 T A 16: 19,957,139 D223V probably damaging Het
Kpna6 A G 4: 129,657,779 S71P possibly damaging Het
Lama3 A G 18: 12,441,131 D590G probably benign Het
Lipt1 T G 1: 37,875,529 L222R probably damaging Het
Lrrc41 A G 4: 116,093,177 probably benign Het
Lrrc59 T C 11: 94,634,672 V98A probably benign Het
Mast4 A G 13: 102,774,184 probably null Het
Mdc1 C T 17: 35,850,394 S733F probably benign Het
Mknk1 C T 4: 115,878,186 probably benign Het
Mtmr7 A G 8: 40,590,462 F141S probably damaging Het
Myo15b A G 11: 115,887,602 D1G possibly damaging Het
Odf3 T C 7: 140,848,278 M1T probably null Het
Olfr1356 T G 10: 78,847,575 L113F probably damaging Het
Phkb T A 8: 85,901,911 V183E probably damaging Het
Pola2 T C 19: 5,953,864 Y161C probably damaging Het
Psen1 G A 12: 83,731,778 V412I probably benign Het
Psmc4 C A 7: 28,047,512 G77V probably damaging Het
Psmd3 A G 11: 98,687,760 Y207C probably damaging Het
Pxk T A 14: 8,130,653 M84K probably damaging Het
Rab44 A C 17: 29,136,337 Q19P probably damaging Het
Rbks A G 5: 31,624,515 Y314H probably benign Het
Rftn2 T C 1: 55,214,240 D68G possibly damaging Het
Rims2 T A 15: 39,535,914 S838R probably damaging Het
Sdc4 A T 2: 164,431,218 D57E probably damaging Het
Slfn14 A G 11: 83,279,156 L554P probably damaging Het
Spink2 G T 5: 77,205,392 D83E possibly damaging Het
Srsf4 C T 4: 131,900,102 probably benign Het
Taar8b A T 10: 24,092,132 S55T possibly damaging Het
Tbca A G 13: 94,832,410 E35G probably benign Het
Tmc5 C A 7: 118,628,829 H307Q probably benign Het
Tmem169 A G 1: 72,298,152 D82G probably benign Het
Tmem72 T C 6: 116,698,358 T58A probably benign Het
Ttc7 C T 17: 87,334,321 P449S probably damaging Het
Ttf2 T C 3: 100,961,406 E449G probably benign Het
Ubr4 C A 4: 139,402,546 T659K probably damaging Het
Wdr1 A G 5: 38,547,029 Y98H probably damaging Het
Wfikkn2 A G 11: 94,239,052 Y88H probably benign Het
Zfp384 A T 6: 125,030,848 H247L probably damaging Het
Zfp526 C T 7: 25,225,870 A518V probably damaging Het
Zfp788 T A 7: 41,647,568 H47Q probably benign Het
Other mutations in 1810055G02Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01024:1810055G02Rik APN 19 3717040 missense probably benign 0.02
IGL02883:1810055G02Rik APN 19 3716972 missense possibly damaging 0.83
R0909:1810055G02Rik UTSW 19 3715788 missense probably benign 0.00
R1482:1810055G02Rik UTSW 19 3717192 missense probably benign 0.01
R2158:1810055G02Rik UTSW 19 3716608 missense possibly damaging 0.46
R5012:1810055G02Rik UTSW 19 3717217 missense possibly damaging 0.92
R5557:1810055G02Rik UTSW 19 3717501 missense possibly damaging 0.66
X0026:1810055G02Rik UTSW 19 3716826 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- TCTACCAGAGTGACAGCAGAG -3'
(R):5'- TGCTGATCTACCTGCTGTGC -3'

Sequencing Primer
(F):5'- TGACAGCAGAGGTGACAACAC -3'
(R):5'- GCTATGCACTGGCTGGTC -3'
Posted On2016-03-01