Incidental Mutation 'R4834:4930550C14Rik'
List |< first << previous [record 93 of 10171] next >> last >|
ID373076
Institutional Source Beutler Lab
Gene Symbol 4930550C14Rik
Ensembl Gene ENSMUSG00000005131
Gene NameRIKEN cDNA 4930550C14 gene
Synonyms
MMRRC Submission 041977-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.135) question?
Stock #R4834 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location53402325-53434402 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 53432487 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Alanine at position 146 (D146A)
Ref Sequence ENSEMBL: ENSMUSP00000149814 (fasta)
Gene Model
Predicted Effect possibly damaging
Transcript: ENSMUST00000005262
AA Change: D291A

PolyPhen 2 Score 0.656 (Sensitivity: 0.87; Specificity: 0.91)
Predicted Effect possibly damaging
Transcript: ENSMUST00000215668
AA Change: D146A

PolyPhen 2 Score 0.780 (Sensitivity: 0.85; Specificity: 0.93)
Predicted Effect possibly damaging
Transcript: ENSMUST00000217318
AA Change: D146A

PolyPhen 2 Score 0.780 (Sensitivity: 0.85; Specificity: 0.93)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsl5 C A 19: 55,280,559 D217E probably benign Het
Acss3 A G 10: 107,084,805 probably null Het
Adam24 G A 8: 40,679,699 G69R probably damaging Het
Adgrg7 A T 16: 56,732,869 W622R probably damaging Het
Ankrd26 T C 6: 118,523,718 M931V probably benign Het
Ano8 C T 8: 71,484,295 V187M probably damaging Het
Ap3d1 A T 10: 80,719,726 C348S probably damaging Het
Apob T C 12: 8,014,101 V376A possibly damaging Het
Arhgap21 A T 2: 20,865,319 D925E probably damaging Het
Bmp6 T A 13: 38,485,841 V367E probably damaging Het
Bmp8b A T 4: 123,123,050 Q348L probably damaging Het
Ccr1l1 T C 9: 123,977,705 K235R probably damaging Het
Cd59a G A 2: 104,114,086 C93Y probably damaging Het
Clstn3 C T 6: 124,431,953 probably null Het
Col4a2 C A 8: 11,406,836 Y236* probably null Het
Csn1s2a T C 5: 87,781,778 F79L probably benign Het
Cyp4a10 A C 4: 115,525,808 Y360S probably damaging Het
Cyp4a29 A T 4: 115,249,670 I175F probably benign Het
D11Wsu47e C A 11: 113,688,979 T400K probably benign Het
Dck T A 5: 88,772,736 I105N probably damaging Het
Dicer1 A G 12: 104,696,591 L1577P probably benign Het
Dirc2 T A 16: 35,735,575 T172S probably benign Het
Disp2 G A 2: 118,792,504 S1239N probably benign Het
Dopey2 T C 16: 93,740,004 M1T probably null Het
E130308A19Rik T A 4: 59,690,317 C50* probably null Het
Elf2 A T 3: 51,277,221 D14E probably damaging Het
Epm2aip1 C T 9: 111,273,194 R412C probably benign Het
Foxm1 T C 6: 128,369,447 F114L probably damaging Het
Glcci1 C T 6: 8,582,601 R134* probably null Het
Gm996 T C 2: 25,579,518 E127G possibly damaging Het
Gspt1 T C 16: 11,222,717 K576E probably damaging Het
H2-M10.3 T C 17: 36,367,394 K180E probably benign Het
Hecw2 A T 1: 53,830,752 V1439E probably damaging Het
Hr T C 14: 70,559,922 S561P probably damaging Het
Hunk T C 16: 90,496,198 V456A probably benign Het
Il1rap T A 16: 26,676,935 D97E probably damaging Het
Inpp5d T G 1: 87,697,523 V474G possibly damaging Het
Itsn1 T A 16: 91,906,789 L87* probably null Het
Izumo3 T C 4: 92,146,971 D3G possibly damaging Het
Kifc2 T A 15: 76,661,311 M1K probably null Het
Krt8 T A 15: 101,998,821 I276F probably damaging Het
Ksr2 C A 5: 117,668,327 Q402K probably benign Het
Lama2 A G 10: 27,006,749 V2606A probably benign Het
Met A G 6: 17,491,413 H58R probably damaging Het
Mier3 C T 13: 111,715,109 Q542* probably null Het
Msh2 C A 17: 87,723,413 A906E probably benign Het
Msl3l2 C T 10: 56,115,559 R127C probably damaging Het
Naglu T C 11: 101,076,988 L588P probably benign Het
Nf1 T C 11: 79,546,297 L2013P probably damaging Het
Nid1 A G 13: 13,508,823 Y1162C probably damaging Het
Nlrc5 G T 8: 94,505,485 R1313L probably benign Het
Nrg1 A G 8: 31,917,719 V162A probably benign Het
Nup188 T C 2: 30,339,584 L1310P probably damaging Het
Ofcc1 G A 13: 40,015,388 T841I probably damaging Het
Olfr1310 A G 2: 112,008,931 L85P probably damaging Het
Olfr290 T G 7: 84,916,283 F168C probably damaging Het
Olfr305 G A 7: 86,363,744 L198F probably benign Het
Pbk T A 14: 65,815,284 L192* probably null Het
Pcdhga4 T C 18: 37,685,437 I13T probably benign Het
Peg10 A T 6: 4,754,294 probably benign Het
Polq T A 16: 37,027,814 V261D probably damaging Het
Ppp2r5b T A 19: 6,230,510 T313S possibly damaging Het
Ptk2 A T 15: 73,216,096 probably null Het
Ptpn7 T A 1: 135,137,880 probably null Het
Rab11fip1 A G 8: 27,153,083 S563P probably damaging Het
Scn1a A T 2: 66,328,522 C351* probably null Het
Slc10a5 A T 3: 10,334,799 V267D probably damaging Het
Slc37a2 T A 9: 37,235,108 M368L probably damaging Het
Slc6a20b T A 9: 123,596,048 T585S probably benign Het
Srcap T C 7: 127,557,610 probably null Het
Tbx18 T C 9: 87,727,449 M178V possibly damaging Het
Tmprss11b C A 5: 86,663,559 C172F probably damaging Het
Traf5 T C 1: 192,066,898 Q91R probably benign Het
Trappc8 A T 18: 20,825,065 Y1248N probably damaging Het
Trpa1 A G 1: 14,896,523 L539S possibly damaging Het
Tyrp1 T A 4: 80,846,596 Y3* probably null Het
Ubr7 A T 12: 102,761,502 K94N probably damaging Het
Ugt2a1 C A 5: 87,486,035 probably null Het
Unc50 T A 1: 37,432,629 I120K probably damaging Het
Usp28 T C 9: 49,001,536 V29A probably damaging Het
Usp9y A G Y: 1,317,002 I1849T probably benign Het
Vmn2r102 T A 17: 19,677,941 V406E probably damaging Het
Vmn2r4 G A 3: 64,410,063 R85W probably benign Het
Xirp2 A G 2: 67,516,406 D2997G probably benign Het
Zc2hc1c A T 12: 85,290,208 E213V probably damaging Het
Zfp420 C T 7: 29,874,334 probably benign Het
Zfp641 C T 15: 98,293,704 E34K probably damaging Het
Other mutations in 4930550C14Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0310:4930550C14Rik UTSW 9 53425671 missense probably damaging 1.00
R0625:4930550C14Rik UTSW 9 53408065 missense probably benign
R1104:4930550C14Rik UTSW 9 53421617 missense probably benign 0.28
R1292:4930550C14Rik UTSW 9 53425619 missense probably benign 0.20
R2182:4930550C14Rik UTSW 9 53422943 missense probably damaging 1.00
R3924:4930550C14Rik UTSW 9 53432405 missense probably benign
R4756:4930550C14Rik UTSW 9 53425530 missense probably benign
R4757:4930550C14Rik UTSW 9 53425530 missense probably benign
R5244:4930550C14Rik UTSW 9 53411798 missense probably damaging 1.00
R6151:4930550C14Rik UTSW 9 53414383 missense probably damaging 1.00
R6353:4930550C14Rik UTSW 9 53414342 missense probably benign 0.00
R6376:4930550C14Rik UTSW 9 53428156 missense probably damaging 0.98
R6988:4930550C14Rik UTSW 9 53411756 missense possibly damaging 0.63
Predicted Primers PCR Primer
(F):5'- CATGTGCTCAAAGTGTGGAC -3'
(R):5'- GACGTACACATGTCATTGTAGTCAG -3'

Sequencing Primer
(F):5'- GAACAGGGTTTCTCTATGTAGCCC -3'
(R):5'- AGAATAAGTAGTTTCTTGGCTTTCGC -3'
Posted On2016-03-01