Incidental Mutation 'R4835:Col5a1'
ID373125
Institutional Source Beutler Lab
Gene Symbol Col5a1
Ensembl Gene ENSMUSG00000026837
Gene Namecollagen, type V, alpha 1
Synonyms
MMRRC Submission 042450-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4835 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location27886425-28039514 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 28025644 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glycine at position 180 (V180G)
Ref Sequence ENSEMBL: ENSMUSP00000123532 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028280] [ENSMUST00000145423]
Predicted Effect unknown
Transcript: ENSMUST00000028280
AA Change: V1669G
SMART Domains Protein: ENSMUSP00000028280
Gene: ENSMUSG00000026837
AA Change: V1669G

DomainStartEndE-ValueType
signal peptide 1 36 N/A INTRINSIC
TSPN 39 230 5.7e-73 SMART
LamG 98 229 6.86e-3 SMART
low complexity region 259 288 N/A INTRINSIC
low complexity region 300 314 N/A INTRINSIC
low complexity region 335 352 N/A INTRINSIC
low complexity region 374 387 N/A INTRINSIC
low complexity region 412 428 N/A INTRINSIC
internal_repeat_7 443 457 9.97e-7 PROSPERO
Pfam:Collagen 467 519 4e-10 PFAM
Pfam:Collagen 557 619 6.5e-9 PFAM
internal_repeat_2 622 642 1.83e-11 PROSPERO
low complexity region 643 698 N/A INTRINSIC
low complexity region 712 757 N/A INTRINSIC
low complexity region 760 793 N/A INTRINSIC
internal_repeat_5 794 817 3.78e-8 PROSPERO
internal_repeat_7 798 812 9.97e-7 PROSPERO
internal_repeat_8 802 821 8.84e-6 PROSPERO
low complexity region 826 862 N/A INTRINSIC
internal_repeat_3 865 889 2.79e-10 PROSPERO
internal_repeat_5 869 892 3.78e-8 PROSPERO
low complexity region 895 925 N/A INTRINSIC
internal_repeat_2 928 948 1.83e-11 PROSPERO
internal_repeat_4 928 948 1.27e-8 PROSPERO
low complexity region 949 979 N/A INTRINSIC
low complexity region 984 1033 N/A INTRINSIC
internal_repeat_4 1039 1062 1.27e-8 PROSPERO
internal_repeat_1 1039 1063 5.12e-15 PROSPERO
internal_repeat_3 1048 1072 2.79e-10 PROSPERO
internal_repeat_6 1049 1072 1.13e-7 PROSPERO
low complexity region 1075 1117 N/A INTRINSIC
low complexity region 1134 1165 N/A INTRINSIC
low complexity region 1174 1193 N/A INTRINSIC
internal_repeat_8 1195 1214 8.84e-6 PROSPERO
low complexity region 1215 1243 N/A INTRINSIC
low complexity region 1249 1282 N/A INTRINSIC
low complexity region 1285 1421 N/A INTRINSIC
internal_repeat_1 1423 1447 5.12e-15 PROSPERO
Pfam:Collagen 1460 1529 8.4e-9 PFAM
Pfam:Collagen 1513 1575 1.2e-9 PFAM
COLFI 1608 1837 3.33e-153 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123129
Predicted Effect probably damaging
Transcript: ENSMUST00000145423
AA Change: V180G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000123532
Gene: ENSMUSG00000026837
AA Change: V180G

DomainStartEndE-ValueType
Pfam:Collagen 1 50 2.7e-10 PFAM
COLFI 119 348 3.33e-153 SMART
Meta Mutation Damage Score 0.578 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.8%
Validation Efficiency 98% (96/98)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an alpha chain for one of the low abundance fibrillar collagens. Fibrillar collagen molecules are trimers that can be composed of one or more types of alpha chains. Type V collagen is found in tissues containing type I collagen and appears to regulate the assembly of heterotypic fibers composed of both type I and type V collagen. This gene product is closely related to type XI collagen and it is possible that the collagen chains of types V and XI constitute a single collagen type with tissue-specific chain combinations. The encoded procollagen protein occurs commonly as the heterotrimer pro-alpha1(V)-pro-alpha1(V)-pro-alpha2(V). Mutations in this gene are associated with Ehlers-Danlos syndrome, types I and II. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, May 2013]
PHENOTYPE: Homozygous mutation of this gene results in lethality around E10-11 due to cardiovascular insufficiency and lack of collagen fibril formation. Heterozygotes exhibit poorly organized and less dense fibers in the dermis and reduced skin tensile strength and are a model for Ehlers-Danlos Syndrome. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 91 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930432E11Rik A T 7: 29,574,901 noncoding transcript Het
4933434E20Rik A G 3: 90,063,209 N17D probably benign Het
A1bg T C 15: 60,920,251 D176G probably benign Het
Abcg5 A T 17: 84,658,648 M428K possibly damaging Het
Adam1a A T 5: 121,519,689 C514S probably damaging Het
Angptl3 A G 4: 99,037,412 Q325R probably benign Het
Ankrd26 C T 6: 118,548,850 W378* probably null Het
Apob T C 12: 8,015,391 V4087A possibly damaging Het
Auts2 A G 5: 131,466,093 I117T probably damaging Het
AW146154 T A 7: 41,480,468 E408V probably damaging Het
Bicd1 A T 6: 149,484,090 N107I probably benign Het
Blm T C 7: 80,509,546 S281G probably benign Het
Btaf1 T A 19: 37,002,458 D1542E probably benign Het
C2cd2l A G 9: 44,315,145 probably null Het
Capn8 C A 1: 182,604,551 N362K probably damaging Het
Ccdc14 T G 16: 34,705,038 S186A probably damaging Het
Cdca4 A G 12: 112,821,547 L187P probably damaging Het
Chil6 T A 3: 106,405,974 K20* probably null Het
Cmss1 A T 16: 57,316,182 L109* probably null Het
Cmtm6 G T 9: 114,731,342 W36L probably benign Het
Cnksr3 T G 10: 7,160,757 I35L possibly damaging Het
Col4a2 G T 8: 11,423,570 G534* probably null Het
Ctnna3 T C 10: 63,581,944 F154L probably benign Het
Fabp7 G A 10: 57,785,580 V50M possibly damaging Het
Fam170a T A 18: 50,281,983 V232D probably damaging Het
Fam186a T G 15: 99,945,808 T852P unknown Het
Fam20a T C 11: 109,673,563 I455V probably benign Het
Fbxl6 C T 15: 76,536,804 V324M probably damaging Het
Galnt18 T C 7: 111,779,523 T9A probably damaging Het
Golgb1 T A 16: 36,891,407 M191K possibly damaging Het
Gpld1 A G 13: 24,982,716 T650A probably benign Het
Gprc5d A G 6: 135,116,517 F131L probably benign Het
H2afv C T 11: 6,439,437 G7E unknown Het
Haus4 A T 14: 54,545,835 probably null Het
Helq A G 5: 100,774,163 I725T possibly damaging Het
Igsf23 T A 7: 19,941,830 D117V possibly damaging Het
Kiz A T 2: 146,942,088 S514C probably damaging Het
Klhl6 A T 16: 19,957,033 N258K probably benign Het
Krt72 G C 15: 101,781,073 probably null Het
Large1 A T 8: 73,048,347 I245N probably damaging Het
Lrrc31 T C 3: 30,679,157 I469M probably damaging Het
Lypd4 T A 7: 24,866,696 I68F probably benign Het
Mast1 A G 8: 84,923,779 S442P probably damaging Het
Mmp20 T A 9: 7,645,299 H283Q probably benign Het
Mrps5 G A 2: 127,603,707 V385M possibly damaging Het
Ms4a15 T C 19: 10,979,226 K241E possibly damaging Het
Myt1 A G 2: 181,797,462 E259G probably damaging Het
Myt1l C A 12: 29,895,305 T1023K unknown Het
Ncapd3 T C 9: 27,086,046 L1221P probably damaging Het
Ncoa6 A G 2: 155,407,133 V1417A possibly damaging Het
Nmnat1 A G 4: 149,473,345 V80A possibly damaging Het
Nwd2 A G 5: 63,807,846 E1591G probably benign Het
Olfr1057 A G 2: 86,374,509 L301S possibly damaging Het
Olfr455 A G 6: 42,538,836 F62S probably damaging Het
Osbpl1a A T 18: 12,768,536 probably null Het
Papln T C 12: 83,774,420 I204T probably damaging Het
Phf1 A G 17: 26,934,678 T97A probably benign Het
Plxnb1 A G 9: 109,105,374 D890G probably damaging Het
Ppp1r12b G T 1: 134,955,733 A17E probably benign Het
Ptgir A G 7: 16,906,869 M29V possibly damaging Het
Rbp2 G A 9: 98,507,823 C96Y probably damaging Het
Rgmb A T 17: 15,807,362 M365K possibly damaging Het
Ric1 A G 19: 29,595,536 N792S possibly damaging Het
Ruvbl1 T C 6: 88,497,229 Y405H possibly damaging Het
Scaf4 A G 16: 90,250,307 M394T unknown Het
Siglech T A 7: 55,768,429 C48* probably null Het
Skiv2l A G 17: 34,842,921 V695A possibly damaging Het
Slc2a5 A G 4: 150,140,005 T320A probably benign Het
Slc6a7 T C 18: 61,002,205 Y417C probably benign Het
Sox21 A G 14: 118,234,924 C238R possibly damaging Het
Tbata A T 10: 61,183,353 K109N probably damaging Het
Tecpr2 T G 12: 110,954,730 S1246A probably benign Het
Tekt3 A G 11: 63,081,259 D247G probably benign Het
Tenm3 A T 8: 48,313,236 probably null Het
Thada A T 17: 84,441,104 probably null Het
Tpcn2 C T 7: 145,272,351 G204R probably damaging Het
Tpm2 T C 4: 43,519,220 probably null Het
Trbv24 T C 6: 41,218,092 probably benign Het
Tyw1 A G 5: 130,277,058 R341G probably benign Het
Vmn1r183 T G 7: 24,055,139 N122K probably benign Het
Vmn2r61 T A 7: 42,267,035 H357Q possibly damaging Het
Vps13b C T 15: 35,869,372 T2674I probably damaging Het
Vps13b T C 15: 35,910,293 L3401P probably benign Het
Vps16 T G 2: 130,438,300 probably benign Het
Vrtn T A 12: 84,649,694 I406N probably damaging Het
Vwa8 A T 14: 78,934,613 Y278F probably benign Het
Washc4 A T 10: 83,579,512 I789F possibly damaging Het
Zbtb20 C A 16: 43,618,398 T627K probably damaging Het
Zfyve16 A T 13: 92,522,185 I406K probably benign Het
Zfyve9 A C 4: 108,717,998 S629A possibly damaging Het
Zpld1 A T 16: 55,248,255 N164K probably damaging Het
Other mutations in Col5a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01291:Col5a1 APN 2 27971444 splice site probably benign
IGL01340:Col5a1 APN 2 27960451 missense unknown
IGL01938:Col5a1 APN 2 27996873 missense unknown
IGL02167:Col5a1 APN 2 28018556 missense probably benign
IGL02670:Col5a1 APN 2 27974715 missense unknown
IGL02672:Col5a1 APN 2 27974715 missense unknown
IGL02673:Col5a1 APN 2 27974715 missense unknown
IGL02832:Col5a1 APN 2 27952340 missense unknown
IGL03065:Col5a1 APN 2 28032745 missense possibly damaging 0.61
IGL03196:Col5a1 APN 2 27975598 missense unknown
PIT4131001:Col5a1 UTSW 2 28024653 missense probably benign 0.01
PIT4495001:Col5a1 UTSW 2 28024776 missense unknown
R0136:Col5a1 UTSW 2 28024831 missense probably damaging 1.00
R0485:Col5a1 UTSW 2 27990097 splice site probably benign
R0626:Col5a1 UTSW 2 27928243 nonsense probably null
R0666:Col5a1 UTSW 2 28032685 missense probably damaging 1.00
R1268:Col5a1 UTSW 2 28002489 missense unknown
R1302:Col5a1 UTSW 2 28005236 missense probably damaging 1.00
R1416:Col5a1 UTSW 2 27922064 missense unknown
R1466:Col5a1 UTSW 2 28003846 splice site probably benign
R1617:Col5a1 UTSW 2 27952381 missense unknown
R1650:Col5a1 UTSW 2 27922159 missense unknown
R1663:Col5a1 UTSW 2 27951476 missense unknown
R1901:Col5a1 UTSW 2 27960444 missense unknown
R1970:Col5a1 UTSW 2 27986754 missense unknown
R2377:Col5a1 UTSW 2 27928177 missense unknown
R2396:Col5a1 UTSW 2 27986729 missense unknown
R4297:Col5a1 UTSW 2 28017204 critical splice donor site probably null
R4385:Col5a1 UTSW 2 28024779 missense probably damaging 1.00
R4803:Col5a1 UTSW 2 28011341 missense unknown
R4935:Col5a1 UTSW 2 28024742 missense probably damaging 1.00
R4994:Col5a1 UTSW 2 28032739 missense possibly damaging 0.90
R4997:Col5a1 UTSW 2 28032782 nonsense probably null
R5061:Col5a1 UTSW 2 27952378 missense unknown
R5088:Col5a1 UTSW 2 28018602 nonsense probably null
R5089:Col5a1 UTSW 2 28018602 nonsense probably null
R5090:Col5a1 UTSW 2 28018602 nonsense probably null
R5114:Col5a1 UTSW 2 28025652 missense probably damaging 1.00
R5409:Col5a1 UTSW 2 27960445 missense unknown
R5649:Col5a1 UTSW 2 27951456 missense unknown
R5699:Col5a1 UTSW 2 27997599 missense unknown
R5910:Col5a1 UTSW 2 28036888 missense possibly damaging 0.89
R6053:Col5a1 UTSW 2 28014377 unclassified probably benign
R6210:Col5a1 UTSW 2 28032621 missense probably benign 0.04
R6363:Col5a1 UTSW 2 27928195 missense unknown
R6478:Col5a1 UTSW 2 27952436 missense unknown
R6600:Col5a1 UTSW 2 27997571 missense unknown
R7047:Col5a1 UTSW 2 27928084 missense unknown
R7061:Col5a1 UTSW 2 28025678 nonsense probably null
R7131:Col5a1 UTSW 2 27929486 missense unknown
Predicted Primers PCR Primer
(F):5'- ATGCTCCCCTCAGGAAAAGC -3'
(R):5'- GAATGTTCTTGGTACTGAAAGTGACTG -3'

Sequencing Primer
(F):5'- CCCTCAGGAAAAGCAAAGTACTGTG -3'
(R):5'- ACTGAAAGTGACTGTCTGCTG -3'
Posted On2016-03-01