Incidental Mutation 'R4835:Plxnb1'
ID373165
Institutional Source Beutler Lab
Gene Symbol Plxnb1
Ensembl Gene ENSMUSG00000053646
Gene Nameplexin B1
Synonyms2900002G15Rik
MMRRC Submission 042450-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4835 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location109095389-109119917 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 109105374 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 890 (D890G)
Ref Sequence ENSEMBL: ENSMUSP00000071966 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072093] [ENSMUST00000130366] [ENSMUST00000131462]
Predicted Effect probably damaging
Transcript: ENSMUST00000072093
AA Change: D890G

PolyPhen 2 Score 0.959 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000071966
Gene: ENSMUSG00000053646
AA Change: D890G

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Sema 35 463 5.84e-101 SMART
PSI 481 534 1.17e-13 SMART
PSI 628 678 6.97e-3 SMART
low complexity region 691 706 N/A INTRINSIC
low complexity region 752 771 N/A INTRINSIC
PSI 1019 1066 2.06e-5 SMART
IPT 1067 1158 7.48e-18 SMART
IPT 1159 1247 3.97e-22 SMART
IPT 1249 1359 6.09e-9 SMART
low complexity region 1483 1494 N/A INTRINSIC
Pfam:Plexin_cytopl 1546 2086 6.5e-230 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000130366
SMART Domains Protein: ENSMUSP00000114358
Gene: ENSMUSG00000053646

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Sema 35 138 7.5e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000131462
SMART Domains Protein: ENSMUSP00000115265
Gene: ENSMUSG00000053646

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Sema 35 138 7.5e-11 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192117
Predicted Effect probably benign
Transcript: ENSMUST00000192988
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194734
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195364
Meta Mutation Damage Score 0.092 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.8%
Validation Efficiency 98% (96/98)
MGI Phenotype PHENOTYPE: Homozygous null mutants are viable and fertile and show no apparent defects in development, adult histology or basic functional parameters. However, a transitory renal phenotype, characterized by increased ureteric branching and enlarged kidneys, is noted over early stages of renal development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 91 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930432E11Rik A T 7: 29,574,901 noncoding transcript Het
4933434E20Rik A G 3: 90,063,209 N17D probably benign Het
A1bg T C 15: 60,920,251 D176G probably benign Het
Abcg5 A T 17: 84,658,648 M428K possibly damaging Het
Adam1a A T 5: 121,519,689 C514S probably damaging Het
Angptl3 A G 4: 99,037,412 Q325R probably benign Het
Ankrd26 C T 6: 118,548,850 W378* probably null Het
Apob T C 12: 8,015,391 V4087A possibly damaging Het
Auts2 A G 5: 131,466,093 I117T probably damaging Het
AW146154 T A 7: 41,480,468 E408V probably damaging Het
Bicd1 A T 6: 149,484,090 N107I probably benign Het
Blm T C 7: 80,509,546 S281G probably benign Het
Btaf1 T A 19: 37,002,458 D1542E probably benign Het
C2cd2l A G 9: 44,315,145 probably null Het
Capn8 C A 1: 182,604,551 N362K probably damaging Het
Ccdc14 T G 16: 34,705,038 S186A probably damaging Het
Cdca4 A G 12: 112,821,547 L187P probably damaging Het
Chil6 T A 3: 106,405,974 K20* probably null Het
Cmss1 A T 16: 57,316,182 L109* probably null Het
Cmtm6 G T 9: 114,731,342 W36L probably benign Het
Cnksr3 T G 10: 7,160,757 I35L possibly damaging Het
Col4a2 G T 8: 11,423,570 G534* probably null Het
Col5a1 T G 2: 28,025,644 V180G probably damaging Het
Ctnna3 T C 10: 63,581,944 F154L probably benign Het
Fabp7 G A 10: 57,785,580 V50M possibly damaging Het
Fam170a T A 18: 50,281,983 V232D probably damaging Het
Fam186a T G 15: 99,945,808 T852P unknown Het
Fam20a T C 11: 109,673,563 I455V probably benign Het
Fbxl6 C T 15: 76,536,804 V324M probably damaging Het
Galnt18 T C 7: 111,779,523 T9A probably damaging Het
Golgb1 T A 16: 36,891,407 M191K possibly damaging Het
Gpld1 A G 13: 24,982,716 T650A probably benign Het
Gprc5d A G 6: 135,116,517 F131L probably benign Het
H2afv C T 11: 6,439,437 G7E unknown Het
Haus4 A T 14: 54,545,835 probably null Het
Helq A G 5: 100,774,163 I725T possibly damaging Het
Igsf23 T A 7: 19,941,830 D117V possibly damaging Het
Kiz A T 2: 146,942,088 S514C probably damaging Het
Klhl6 A T 16: 19,957,033 N258K probably benign Het
Krt72 G C 15: 101,781,073 probably null Het
Large1 A T 8: 73,048,347 I245N probably damaging Het
Lrrc31 T C 3: 30,679,157 I469M probably damaging Het
Lypd4 T A 7: 24,866,696 I68F probably benign Het
Mast1 A G 8: 84,923,779 S442P probably damaging Het
Mmp20 T A 9: 7,645,299 H283Q probably benign Het
Mrps5 G A 2: 127,603,707 V385M possibly damaging Het
Ms4a15 T C 19: 10,979,226 K241E possibly damaging Het
Myt1 A G 2: 181,797,462 E259G probably damaging Het
Myt1l C A 12: 29,895,305 T1023K unknown Het
Ncapd3 T C 9: 27,086,046 L1221P probably damaging Het
Ncoa6 A G 2: 155,407,133 V1417A possibly damaging Het
Nmnat1 A G 4: 149,473,345 V80A possibly damaging Het
Nwd2 A G 5: 63,807,846 E1591G probably benign Het
Olfr1057 A G 2: 86,374,509 L301S possibly damaging Het
Olfr455 A G 6: 42,538,836 F62S probably damaging Het
Osbpl1a A T 18: 12,768,536 probably null Het
Papln T C 12: 83,774,420 I204T probably damaging Het
Phf1 A G 17: 26,934,678 T97A probably benign Het
Ppp1r12b G T 1: 134,955,733 A17E probably benign Het
Ptgir A G 7: 16,906,869 M29V possibly damaging Het
Rbp2 G A 9: 98,507,823 C96Y probably damaging Het
Rgmb A T 17: 15,807,362 M365K possibly damaging Het
Ric1 A G 19: 29,595,536 N792S possibly damaging Het
Ruvbl1 T C 6: 88,497,229 Y405H possibly damaging Het
Scaf4 A G 16: 90,250,307 M394T unknown Het
Siglech T A 7: 55,768,429 C48* probably null Het
Skiv2l A G 17: 34,842,921 V695A possibly damaging Het
Slc2a5 A G 4: 150,140,005 T320A probably benign Het
Slc6a7 T C 18: 61,002,205 Y417C probably benign Het
Sox21 A G 14: 118,234,924 C238R possibly damaging Het
Tbata A T 10: 61,183,353 K109N probably damaging Het
Tecpr2 T G 12: 110,954,730 S1246A probably benign Het
Tekt3 A G 11: 63,081,259 D247G probably benign Het
Tenm3 A T 8: 48,313,236 probably null Het
Thada A T 17: 84,441,104 probably null Het
Tpcn2 C T 7: 145,272,351 G204R probably damaging Het
Tpm2 T C 4: 43,519,220 probably null Het
Trbv24 T C 6: 41,218,092 probably benign Het
Tyw1 A G 5: 130,277,058 R341G probably benign Het
Vmn1r183 T G 7: 24,055,139 N122K probably benign Het
Vmn2r61 T A 7: 42,267,035 H357Q possibly damaging Het
Vps13b C T 15: 35,869,372 T2674I probably damaging Het
Vps13b T C 15: 35,910,293 L3401P probably benign Het
Vps16 T G 2: 130,438,300 probably benign Het
Vrtn T A 12: 84,649,694 I406N probably damaging Het
Vwa8 A T 14: 78,934,613 Y278F probably benign Het
Washc4 A T 10: 83,579,512 I789F possibly damaging Het
Zbtb20 C A 16: 43,618,398 T627K probably damaging Het
Zfyve16 A T 13: 92,522,185 I406K probably benign Het
Zfyve9 A C 4: 108,717,998 S629A possibly damaging Het
Zpld1 A T 16: 55,248,255 N164K probably damaging Het
Other mutations in Plxnb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00593:Plxnb1 APN 9 109113868 missense probably benign 0.04
IGL01014:Plxnb1 APN 9 109106034 missense probably benign 0.00
IGL01142:Plxnb1 APN 9 109102697 missense probably benign 0.05
IGL01454:Plxnb1 APN 9 109113354 missense probably damaging 1.00
IGL01469:Plxnb1 APN 9 109105415 intron probably benign
IGL01530:Plxnb1 APN 9 109110405 missense probably benign 0.02
IGL01599:Plxnb1 APN 9 109110604 missense probably damaging 1.00
IGL01968:Plxnb1 APN 9 109100984 missense probably benign 0.00
IGL02175:Plxnb1 APN 9 109100846 missense possibly damaging 0.85
IGL02216:Plxnb1 APN 9 109100850 missense probably damaging 1.00
IGL02277:Plxnb1 APN 9 109112133 missense probably damaging 1.00
IGL02311:Plxnb1 APN 9 109101122 missense probably benign
IGL02645:Plxnb1 APN 9 109114243 splice site probably benign
IGL03076:Plxnb1 APN 9 109106902 missense probably damaging 0.96
IGL03107:Plxnb1 APN 9 109104986 missense probably benign
IGL03343:Plxnb1 APN 9 109114712 missense probably damaging 1.00
R0117:Plxnb1 UTSW 9 109105218 missense possibly damaging 0.93
R0211:Plxnb1 UTSW 9 109103663 nonsense probably null
R0211:Plxnb1 UTSW 9 109103663 nonsense probably null
R0843:Plxnb1 UTSW 9 109113701 missense probably benign 0.20
R0970:Plxnb1 UTSW 9 109103263 missense probably damaging 1.00
R0973:Plxnb1 UTSW 9 109102142 missense possibly damaging 0.47
R1342:Plxnb1 UTSW 9 109100652 missense possibly damaging 0.87
R1386:Plxnb1 UTSW 9 109101023 missense probably benign 0.27
R1419:Plxnb1 UTSW 9 109114386 missense probably damaging 1.00
R1445:Plxnb1 UTSW 9 109108921 missense probably null
R1548:Plxnb1 UTSW 9 109100900 missense possibly damaging 0.95
R1621:Plxnb1 UTSW 9 109106805 missense probably benign 0.04
R1658:Plxnb1 UTSW 9 109102871 nonsense probably null
R1727:Plxnb1 UTSW 9 109101057 unclassified probably null
R1750:Plxnb1 UTSW 9 109111768 missense probably benign 0.00
R1795:Plxnb1 UTSW 9 109100745 missense probably benign
R1929:Plxnb1 UTSW 9 109102708 splice site probably null
R1935:Plxnb1 UTSW 9 109095647 critical splice donor site probably null
R1936:Plxnb1 UTSW 9 109095647 critical splice donor site probably null
R2014:Plxnb1 UTSW 9 109106619 splice site probably benign
R2057:Plxnb1 UTSW 9 109109226 missense possibly damaging 0.71
R2102:Plxnb1 UTSW 9 109115742 missense probably damaging 1.00
R2271:Plxnb1 UTSW 9 109102708 splice site probably null
R2422:Plxnb1 UTSW 9 109108438 missense probably benign 0.02
R2881:Plxnb1 UTSW 9 109114412 missense probably damaging 1.00
R3409:Plxnb1 UTSW 9 109106613 splice site probably null
R3417:Plxnb1 UTSW 9 109100760 missense probably damaging 0.97
R3756:Plxnb1 UTSW 9 109113458 unclassified probably benign
R3788:Plxnb1 UTSW 9 109109287 missense possibly damaging 0.89
R3789:Plxnb1 UTSW 9 109109287 missense possibly damaging 0.89
R4042:Plxnb1 UTSW 9 109105173 missense probably benign 0.00
R4289:Plxnb1 UTSW 9 109114352 missense probably damaging 1.00
R4396:Plxnb1 UTSW 9 109100223 missense possibly damaging 0.51
R4564:Plxnb1 UTSW 9 109113420 missense probably benign 0.10
R4676:Plxnb1 UTSW 9 109110435 missense possibly damaging 0.63
R4706:Plxnb1 UTSW 9 109112028 missense probably damaging 1.00
R4792:Plxnb1 UTSW 9 109110648 missense probably damaging 1.00
R4796:Plxnb1 UTSW 9 109114595 missense probably damaging 1.00
R4901:Plxnb1 UTSW 9 109104959 missense probably benign 0.01
R4952:Plxnb1 UTSW 9 109114836 missense probably damaging 1.00
R5005:Plxnb1 UTSW 9 109106579 missense probably benign 0.00
R5015:Plxnb1 UTSW 9 109100430 missense possibly damaging 0.95
R5029:Plxnb1 UTSW 9 109114655 missense probably damaging 1.00
R5180:Plxnb1 UTSW 9 109111693 unclassified probably null
R5256:Plxnb1 UTSW 9 109114593 missense probably damaging 1.00
R5285:Plxnb1 UTSW 9 109108459 missense probably damaging 0.99
R5431:Plxnb1 UTSW 9 109100772 missense probably damaging 1.00
R5444:Plxnb1 UTSW 9 109106453 missense probably benign 0.22
R5546:Plxnb1 UTSW 9 109100750 missense probably damaging 1.00
R5852:Plxnb1 UTSW 9 109106450 missense probably damaging 1.00
R5892:Plxnb1 UTSW 9 109111707 missense probably damaging 1.00
R6020:Plxnb1 UTSW 9 109116611 missense probably damaging 1.00
R6053:Plxnb1 UTSW 9 109111707 missense probably damaging 1.00
R6177:Plxnb1 UTSW 9 109102925 unclassified probably null
R6193:Plxnb1 UTSW 9 109104903 missense probably benign
R6274:Plxnb1 UTSW 9 109112141 critical splice donor site probably null
R6310:Plxnb1 UTSW 9 109109728 missense probably damaging 0.96
R6404:Plxnb1 UTSW 9 109116637 missense probably damaging 1.00
R6422:Plxnb1 UTSW 9 109108924 missense probably damaging 1.00
R6479:Plxnb1 UTSW 9 109111665 missense possibly damaging 0.92
R6555:Plxnb1 UTSW 9 109108405 critical splice acceptor site probably null
R6646:Plxnb1 UTSW 9 109108827 missense probably benign
R6648:Plxnb1 UTSW 9 109104330 missense probably benign 0.14
R6661:Plxnb1 UTSW 9 109104299 missense possibly damaging 0.94
R6674:Plxnb1 UTSW 9 109108146 missense probably benign 0.00
R6734:Plxnb1 UTSW 9 109108920 nonsense probably null
R6859:Plxnb1 UTSW 9 109106770 missense probably damaging 1.00
R6948:Plxnb1 UTSW 9 109116634 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- ATGAAGCCCGTTCTGGATTGG -3'
(R):5'- AGGAGCTCACCCTCTGATTC -3'

Sequencing Primer
(F):5'- TGGCTCACCAAAGGAGGC -3'
(R):5'- CCAAGGGTGAGGCAGTCTGTG -3'
Posted On2016-03-01