Incidental Mutation 'R4836:Trp53bp2'
ID373210
Institutional Source Beutler Lab
Gene Symbol Trp53bp2
Ensembl Gene ENSMUSG00000026510
Gene Nametransformation related protein 53 binding protein 2
Synonyms53BP2, ASPP2
MMRRC Submission 042451-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4836 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location182409172-182462432 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 182431582 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Tryptophan at position 67 (R67W)
Ref Sequence ENSEMBL: ENSMUSP00000112508 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000117245]
Predicted Effect probably damaging
Transcript: ENSMUST00000117245
AA Change: R67W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000112508
Gene: ENSMUSG00000026510
AA Change: R67W

DomainStartEndE-ValueType
PDB:2UWQ|A 4 89 1e-53 PDB
Blast:RA 10 91 7e-50 BLAST
coiled coil region 129 306 N/A INTRINSIC
low complexity region 401 412 N/A INTRINSIC
low complexity region 495 512 N/A INTRINSIC
PDB:4IRV|H 728 788 5e-25 PDB
low complexity region 865 890 N/A INTRINSIC
ANK 964 993 2.52e-6 SMART
ANK 997 1026 7.13e-6 SMART
SH3 1066 1124 6.2e-13 SMART
Meta Mutation Damage Score 0.0228 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.2%
Validation Efficiency 98% (87/89)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the ASPP (apoptosis-stimulating protein of p53) family of p53 interacting proteins. The protein contains four ankyrin repeats and an SH3 domain involved in protein-protein interactions. It is localized to the perinuclear region of the cytoplasm, and regulates apoptosis and cell growth through interactions with other regulatory molecules including members of the p53 family. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation is lethal by 30 days of age, although majority die embryonically. Heterozygotes show increased susceptibility to spontaneous and induced tumors of the lymphoma and sarcoma types [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5830411N06Rik T C 7: 140,299,108 I1051T probably benign Het
Acox1 A T 11: 116,175,326 S453T probably benign Het
AF366264 C T 8: 13,838,007 S28N probably benign Het
Ahnak2 A T 12: 112,774,116 V368D probably damaging Het
Ankrd53 A T 6: 83,768,152 Y448F probably damaging Het
Arhgef15 A T 11: 68,949,925 probably benign Het
Atg2b T C 12: 105,646,814 N1166S probably benign Het
Atl3 C T 19: 7,509,545 R77* probably null Het
Bend6 T C 1: 33,883,573 probably benign Het
Ccnt1 C A 15: 98,567,563 R25L probably damaging Het
Cct4 A G 11: 23,002,898 T525A probably benign Het
Cep350 T C 1: 155,928,833 I835V probably damaging Het
Clcn1 G T 6: 42,309,964 V652L probably damaging Het
Cntln T A 4: 85,049,720 Y725* probably null Het
Cog5 T C 12: 31,919,733 F21L probably benign Het
D6Ertd527e GGCAGCAGCAGCA GGCAGCAGCAGCAGCA 6: 87,111,424 probably benign Het
Dnm2 A T 9: 21,491,330 probably benign Het
Dnmt1 C T 9: 20,908,558 V1430I probably damaging Het
Dpep1 A G 8: 123,200,367 D285G probably damaging Het
Eef2kmt C T 16: 5,249,003 V129M probably damaging Het
Epha3 A T 16: 63,583,557 M726K probably damaging Het
Fat3 A G 9: 16,377,723 L168P probably damaging Het
Frem3 T A 8: 80,663,397 F1759Y probably damaging Het
Fubp3 T A 2: 31,608,141 S56R possibly damaging Het
Gm1965 T C 6: 89,145,410 noncoding transcript Het
Gm5592 C T 7: 41,215,534 probably benign Het
Hils1 T A 11: 94,968,017 L46* probably null Het
Irs1 TGGGGTGGACATCGAACTGAAGGAG TG 1: 82,287,732 probably null Het
Isl1 A G 13: 116,303,083 M243T probably benign Het
Itpr1 A T 6: 108,389,537 I142F probably damaging Het
Jak1 T C 4: 101,155,066 T1069A probably damaging Het
Jmjd1c T C 10: 67,233,446 V1848A probably benign Het
Kdm5a T C 6: 120,412,402 V930A probably damaging Het
Kdm5b C A 1: 134,593,315 probably null Het
Lexm T A 4: 106,610,527 probably null Het
Lilra5 T C 7: 4,238,714 F171L possibly damaging Het
Map1b A G 13: 99,431,054 S1720P unknown Het
Mcpt1 A T 14: 56,019,560 Q185L probably damaging Het
Mmp20 T A 9: 7,644,026 D238E possibly damaging Het
Mov10l1 A T 15: 89,020,269 I784F possibly damaging Het
Mroh2b C T 15: 4,904,270 P101S probably damaging Het
Myh3 G T 11: 67,096,939 A1413S probably benign Het
Nat6 A T 9: 107,583,539 Y211F probably damaging Het
Npdc1 G A 2: 25,408,945 D284N probably damaging Het
Olfr1009 A G 2: 85,721,449 I15V probably benign Het
Olfr1054 A T 2: 86,333,227 M43K probably benign Het
Olfr1056 G A 2: 86,355,750 L211F probably benign Het
Olfr1196 A G 2: 88,701,200 I43T probably damaging Het
Olfr330 A C 11: 58,529,482 M168R probably damaging Het
Olfr533 A G 7: 140,467,076 R292G probably damaging Het
Palld T A 8: 61,687,381 T531S probably benign Het
Parp4 A G 14: 56,585,738 E105G probably benign Het
Phf11a A T 14: 59,287,579 S59T probably damaging Het
Ppp1r12b G T 1: 134,955,733 A17E probably benign Het
Rad50 A T 11: 53,650,653 I1252N probably damaging Het
Ramp3 A G 11: 6,674,761 probably null Het
Rrbp1 G A 2: 143,988,417 T610I possibly damaging Het
Slc4a10 A G 2: 62,268,187 Y555C probably damaging Het
Slc5a2 A G 7: 128,267,505 probably null Het
Smoc1 T A 12: 81,179,548 D371E probably damaging Het
Stmn1 T A 4: 134,470,184 probably benign Het
Sulf1 C T 1: 12,842,686 L715F probably benign Het
Surf1 T C 2: 26,914,243 T180A possibly damaging Het
Syne2 A G 12: 75,979,819 I3474V probably damaging Het
Tchh A T 3: 93,445,148 R632W unknown Het
Tchh A T 3: 93,447,588 D1445V unknown Het
Tctn1 A T 5: 122,245,505 M505K probably benign Het
Tdrkh T A 3: 94,425,590 I150N probably damaging Het
Tespa1 C T 10: 130,362,159 T350I probably benign Het
Thbs1 A G 2: 118,115,018 Y326C possibly damaging Het
Tmem208 C T 8: 105,328,664 S119F probably damaging Het
Tmprss6 G C 15: 78,445,388 A91G probably damaging Het
Ttn A G 2: 76,711,197 I25488T possibly damaging Het
Txnl4a A G 18: 80,222,253 E111G probably damaging Het
Unc13b T G 4: 43,237,137 I3402M probably damaging Het
Vmn1r188 A C 13: 22,088,121 I82L probably benign Het
Zfp65 A G 13: 67,708,875 V95A probably benign Het
Zfp985 T A 4: 147,584,155 S493R probably damaging Het
Other mutations in Trp53bp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00672:Trp53bp2 APN 1 182440976 missense probably benign 0.17
IGL00920:Trp53bp2 APN 1 182444654 unclassified probably benign
IGL01336:Trp53bp2 APN 1 182431583 missense probably damaging 1.00
IGL01760:Trp53bp2 APN 1 182448428 missense possibly damaging 0.68
IGL02539:Trp53bp2 APN 1 182448691 missense probably damaging 0.99
IGL02609:Trp53bp2 APN 1 182453724 missense probably benign 0.21
IGL02720:Trp53bp2 APN 1 182453724 missense probably benign 0.21
IGL02962:Trp53bp2 APN 1 182431595 missense probably benign 0.00
IGL03348:Trp53bp2 APN 1 182453748 missense probably damaging 1.00
Nosa UTSW 1 182455740 missense probably damaging 1.00
R0012:Trp53bp2 UTSW 1 182444718 missense probably damaging 0.99
R0012:Trp53bp2 UTSW 1 182444718 missense probably damaging 0.99
R0347:Trp53bp2 UTSW 1 182441648 missense probably benign 0.08
R1422:Trp53bp2 UTSW 1 182446464 missense probably benign
R1833:Trp53bp2 UTSW 1 182429016 missense probably damaging 0.98
R1845:Trp53bp2 UTSW 1 182458903 missense probably damaging 1.00
R1893:Trp53bp2 UTSW 1 182431628 missense probably benign 0.01
R1927:Trp53bp2 UTSW 1 182452664 missense probably damaging 0.98
R2017:Trp53bp2 UTSW 1 182449015 missense probably benign
R2020:Trp53bp2 UTSW 1 182442819 missense probably damaging 1.00
R2072:Trp53bp2 UTSW 1 182458867 missense probably benign 0.00
R2120:Trp53bp2 UTSW 1 182441639 missense probably benign 0.06
R2504:Trp53bp2 UTSW 1 182441639 missense probably benign 0.26
R2970:Trp53bp2 UTSW 1 182431598 missense probably damaging 1.00
R3051:Trp53bp2 UTSW 1 182453782 missense probably damaging 0.96
R3052:Trp53bp2 UTSW 1 182453782 missense probably damaging 0.96
R3053:Trp53bp2 UTSW 1 182453782 missense probably damaging 0.96
R3151:Trp53bp2 UTSW 1 182428960 missense probably damaging 1.00
R4043:Trp53bp2 UTSW 1 182449061 missense possibly damaging 0.93
R4757:Trp53bp2 UTSW 1 182458774 missense probably benign 0.04
R4785:Trp53bp2 UTSW 1 182448997 missense probably benign
R4817:Trp53bp2 UTSW 1 182441805 critical splice donor site probably null
R5040:Trp53bp2 UTSW 1 182444706 missense probably damaging 1.00
R5882:Trp53bp2 UTSW 1 182442212 missense possibly damaging 0.87
R6007:Trp53bp2 UTSW 1 182455740 missense probably damaging 1.00
R6356:Trp53bp2 UTSW 1 182448997 missense probably benign
R6886:Trp53bp2 UTSW 1 182429043 critical splice donor site probably null
R6987:Trp53bp2 UTSW 1 182446635 missense probably damaging 0.99
R7026:Trp53bp2 UTSW 1 182442735 missense probably benign
R7141:Trp53bp2 UTSW 1 182448508 missense
Predicted Primers PCR Primer
(F):5'- ACTGCTTTATACTGACTTGACACTG -3'
(R):5'- CGCTGTTGCTCTAATGTCCTAG -3'

Sequencing Primer
(F):5'- CTTGACACTGATTGTGTAGA -3'
(R):5'- GTTGCTCTAATGTCCTAGCTTCC -3'
Posted On2016-03-01