Incidental Mutation 'R4836:Itpr1'
ID373235
Institutional Source Beutler Lab
Gene Symbol Itpr1
Ensembl Gene ENSMUSG00000030102
Gene Nameinositol 1,4,5-trisphosphate receptor 1
SynonymsP400, Itpr-1, IP3R1, Pcp1, Pcp-1, Ip3r, InsP3R type I, opt
MMRRC Submission 042451-MU
Accession Numbers

NCBI RefSeq: NM_010585.5; MGI: 96623

Is this an essential gene? Possibly essential (E-score: 0.619) question?
Stock #R4836 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location108213096-108551109 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 108389537 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 142 (I142F)
Ref Sequence ENSEMBL: ENSMUSP00000148284 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032192] [ENSMUST00000203615] [ENSMUST00000212125]
Predicted Effect possibly damaging
Transcript: ENSMUST00000032192
AA Change: I974F

PolyPhen 2 Score 0.955 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000032192
Gene: ENSMUSG00000030102
AA Change: I974F

DomainStartEndE-ValueType
MIR 112 166 7.99e-8 SMART
MIR 173 223 1.02e-5 SMART
MIR 231 287 2.33e-9 SMART
MIR 294 403 5.95e-16 SMART
Pfam:RYDR_ITPR 474 670 2.3e-61 PFAM
low complexity region 683 695 N/A INTRINSIC
low complexity region 884 895 N/A INTRINSIC
low complexity region 1004 1020 N/A INTRINSIC
Pfam:RYDR_ITPR 1183 1344 1.9e-14 PFAM
low complexity region 1758 1787 N/A INTRINSIC
Pfam:RIH_assoc 1959 2069 1.2e-33 PFAM
transmembrane domain 2274 2296 N/A INTRINSIC
Pfam:Ion_trans 2311 2600 9e-22 PFAM
coiled coil region 2683 2732 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000203615
AA Change: I974F

PolyPhen 2 Score 0.955 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000144880
Gene: ENSMUSG00000030102
AA Change: I974F

DomainStartEndE-ValueType
MIR 112 166 7.99e-8 SMART
MIR 173 223 1.02e-5 SMART
MIR 231 287 2.33e-9 SMART
MIR 294 403 5.95e-16 SMART
Pfam:RYDR_ITPR 474 670 2.3e-61 PFAM
low complexity region 683 695 N/A INTRINSIC
low complexity region 884 895 N/A INTRINSIC
low complexity region 1004 1020 N/A INTRINSIC
Pfam:RYDR_ITPR 1183 1344 1.9e-14 PFAM
low complexity region 1757 1786 N/A INTRINSIC
Pfam:RIH_assoc 1958 2068 1.2e-33 PFAM
transmembrane domain 2273 2295 N/A INTRINSIC
Pfam:Ion_trans 2310 2599 9e-22 PFAM
coiled coil region 2682 2731 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203995
Predicted Effect probably damaging
Transcript: ENSMUST00000212125
AA Change: I142F

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
Meta Mutation Damage Score 0.318 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.2%
Validation Efficiency 98% (87/89)
MGI Phenotype Strain: 2180360; 3715928; 1856981
Lethality: D10-D21
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an intracellular receptor for inositol 1,4,5-trisphosphate. Upon stimulation by inositol 1,4,5-trisphosphate, this receptor mediates calcium release from the endoplasmic reticulum. Mutations in this gene cause spinocerebellar ataxia type 15, a disease associated with an heterogeneous group of cerebellar disorders. Multiple transcript variants have been identified for this gene. [provided by RefSeq, Nov 2009]
PHENOTYPE: Most homozygotes for a targeted null mutation die in utero, while survivors exhibit severe ataxia, seizures, and lethality by weaning age. Homozygotes for a spontaneous mutation exhibit a postnatal phenotype similar to that of knockout mutants. [provided by MGI curators]
Allele List at MGI

All alleles(71) : Targeted(2) Gene trapped(67) Spontaneous(2)

Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5830411N06Rik T C 7: 140,299,108 I1051T probably benign Het
Acox1 A T 11: 116,175,326 S453T probably benign Het
AF366264 C T 8: 13,838,007 S28N probably benign Het
Ahnak2 A T 12: 112,774,116 V368D probably damaging Het
Ankrd53 A T 6: 83,768,152 Y448F probably damaging Het
Arhgef15 A T 11: 68,949,925 probably benign Het
Atg2b T C 12: 105,646,814 N1166S probably benign Het
Atl3 C T 19: 7,509,545 R77* probably null Het
Bend6 T C 1: 33,883,573 probably benign Het
Ccnt1 C A 15: 98,567,563 R25L probably damaging Het
Cct4 A G 11: 23,002,898 T525A probably benign Het
Cep350 T C 1: 155,928,833 I835V probably damaging Het
Clcn1 G T 6: 42,309,964 V652L probably damaging Het
Cntln T A 4: 85,049,720 Y725* probably null Het
Cog5 T C 12: 31,919,733 F21L probably benign Het
D6Ertd527e GGCAGCAGCAGCA GGCAGCAGCAGCAGCA 6: 87,111,424 probably benign Het
Dnm2 A T 9: 21,491,330 probably benign Het
Dnmt1 C T 9: 20,908,558 V1430I probably damaging Het
Dpep1 A G 8: 123,200,367 D285G probably damaging Het
Eef2kmt C T 16: 5,249,003 V129M probably damaging Het
Epha3 A T 16: 63,583,557 M726K probably damaging Het
Fat3 A G 9: 16,377,723 L168P probably damaging Het
Frem3 T A 8: 80,663,397 F1759Y probably damaging Het
Fubp3 T A 2: 31,608,141 S56R possibly damaging Het
Gm1965 T C 6: 89,145,410 noncoding transcript Het
Gm5592 C T 7: 41,215,534 probably benign Het
Hils1 T A 11: 94,968,017 L46* probably null Het
Irs1 TGGGGTGGACATCGAACTGAAGGAG TG 1: 82,287,732 probably null Het
Isl1 A G 13: 116,303,083 M243T probably benign Het
Jak1 T C 4: 101,155,066 T1069A probably damaging Het
Jmjd1c T C 10: 67,233,446 V1848A probably benign Het
Kdm5a T C 6: 120,412,402 V930A probably damaging Het
Kdm5b C A 1: 134,593,315 probably null Het
Lexm T A 4: 106,610,527 probably null Het
Lilra5 T C 7: 4,238,714 F171L possibly damaging Het
Map1b A G 13: 99,431,054 S1720P unknown Het
Mcpt1 A T 14: 56,019,560 Q185L probably damaging Het
Mmp20 T A 9: 7,644,026 D238E possibly damaging Het
Mov10l1 A T 15: 89,020,269 I784F possibly damaging Het
Mroh2b C T 15: 4,904,270 P101S probably damaging Het
Myh3 G T 11: 67,096,939 A1413S probably benign Het
Nat6 A T 9: 107,583,539 Y211F probably damaging Het
Npdc1 G A 2: 25,408,945 D284N probably damaging Het
Olfr1009 A G 2: 85,721,449 I15V probably benign Het
Olfr1054 A T 2: 86,333,227 M43K probably benign Het
Olfr1056 G A 2: 86,355,750 L211F probably benign Het
Olfr1196 A G 2: 88,701,200 I43T probably damaging Het
Olfr330 A C 11: 58,529,482 M168R probably damaging Het
Olfr533 A G 7: 140,467,076 R292G probably damaging Het
Palld T A 8: 61,687,381 T531S probably benign Het
Parp4 A G 14: 56,585,738 E105G probably benign Het
Phf11a A T 14: 59,287,579 S59T probably damaging Het
Ppp1r12b G T 1: 134,955,733 A17E probably benign Het
Rad50 A T 11: 53,650,653 I1252N probably damaging Het
Ramp3 A G 11: 6,674,761 probably null Het
Rrbp1 G A 2: 143,988,417 T610I possibly damaging Het
Slc4a10 A G 2: 62,268,187 Y555C probably damaging Het
Slc5a2 A G 7: 128,267,505 probably null Het
Smoc1 T A 12: 81,179,548 D371E probably damaging Het
Stmn1 T A 4: 134,470,184 probably benign Het
Sulf1 C T 1: 12,842,686 L715F probably benign Het
Surf1 T C 2: 26,914,243 T180A possibly damaging Het
Syne2 A G 12: 75,979,819 I3474V probably damaging Het
Tchh A T 3: 93,445,148 R632W unknown Het
Tchh A T 3: 93,447,588 D1445V unknown Het
Tctn1 A T 5: 122,245,505 M505K probably benign Het
Tdrkh T A 3: 94,425,590 I150N probably damaging Het
Tespa1 C T 10: 130,362,159 T350I probably benign Het
Thbs1 A G 2: 118,115,018 Y326C possibly damaging Het
Tmem208 C T 8: 105,328,664 S119F probably damaging Het
Tmprss6 G C 15: 78,445,388 A91G probably damaging Het
Trp53bp2 C T 1: 182,431,582 R67W probably damaging Het
Ttn A G 2: 76,711,197 I25488T possibly damaging Het
Txnl4a A G 18: 80,222,253 E111G probably damaging Het
Unc13b T G 4: 43,237,137 I3402M probably damaging Het
Vmn1r188 A C 13: 22,088,121 I82L probably benign Het
Zfp65 A G 13: 67,708,875 V95A probably benign Het
Zfp985 T A 4: 147,584,155 S493R probably damaging Het
Other mutations in Itpr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00979:Itpr1 APN 6 108471120 missense probably damaging 0.98
IGL01073:Itpr1 APN 6 108413820 missense probably benign 0.00
IGL01105:Itpr1 APN 6 108381333 missense probably benign 0.00
IGL01296:Itpr1 APN 6 108399361 missense probably damaging 1.00
IGL01325:Itpr1 APN 6 108381208 missense probably benign 0.01
IGL01418:Itpr1 APN 6 108339624 critical splice donor site probably null
IGL01464:Itpr1 APN 6 108386727 missense possibly damaging 0.95
IGL01467:Itpr1 APN 6 108488496 missense probably damaging 0.96
IGL01645:Itpr1 APN 6 108473599 missense possibly damaging 0.91
IGL01672:Itpr1 APN 6 108381032 nonsense probably null
IGL01969:Itpr1 APN 6 108377691 missense probably damaging 1.00
IGL02164:Itpr1 APN 6 108389483 missense probably benign 0.08
IGL02206:Itpr1 APN 6 108549820 missense probably damaging 1.00
IGL02232:Itpr1 APN 6 108417923 missense probably damaging 1.00
IGL02297:Itpr1 APN 6 108339517 missense possibly damaging 0.84
IGL02434:Itpr1 APN 6 108489922 splice site probably null
IGL02568:Itpr1 APN 6 108339554 missense possibly damaging 0.82
IGL02992:Itpr1 APN 6 108381315 missense probably damaging 1.00
IGL03109:Itpr1 APN 6 108417981 missense probably damaging 1.00
IGL03130:Itpr1 APN 6 108523401 missense probably benign 0.00
IGL03333:Itpr1 APN 6 108380910 unclassified probably benign
aboriginal UTSW 6 108515947 missense probably benign
icarus UTSW 6 108410900 missense probably damaging 1.00
primordial UTSW 6 108518755 missense probably benign 0.06
P0005:Itpr1 UTSW 6 108381257 missense probably damaging 1.00
PIT4366001:Itpr1 UTSW 6 108493757 nonsense probably null
R0019:Itpr1 UTSW 6 108354626 missense probably damaging 1.00
R0128:Itpr1 UTSW 6 108471209 splice site probably benign
R0129:Itpr1 UTSW 6 108349676 missense probably damaging 1.00
R0135:Itpr1 UTSW 6 108488482 splice site probably benign
R0244:Itpr1 UTSW 6 108473589 missense probably benign 0.00
R0391:Itpr1 UTSW 6 108378167 missense probably benign 0.22
R0543:Itpr1 UTSW 6 108515748 splice site probably benign
R0647:Itpr1 UTSW 6 108383698 missense probably damaging 1.00
R0766:Itpr1 UTSW 6 108410900 missense probably damaging 1.00
R0971:Itpr1 UTSW 6 108349629 missense possibly damaging 0.70
R1083:Itpr1 UTSW 6 108510696 missense possibly damaging 0.92
R1277:Itpr1 UTSW 6 108339621 missense probably benign 0.22
R1403:Itpr1 UTSW 6 108389553 missense probably null 1.00
R1403:Itpr1 UTSW 6 108389553 missense probably null 1.00
R1404:Itpr1 UTSW 6 108386648 missense probably benign 0.04
R1404:Itpr1 UTSW 6 108386648 missense probably benign 0.04
R1605:Itpr1 UTSW 6 108349659 missense possibly damaging 0.77
R1661:Itpr1 UTSW 6 108482897 missense probably benign 0.38
R1852:Itpr1 UTSW 6 108386706 missense probably damaging 1.00
R1929:Itpr1 UTSW 6 108493755 missense probably damaging 1.00
R2012:Itpr1 UTSW 6 108440536 missense probably benign 0.02
R2027:Itpr1 UTSW 6 108386853 missense possibly damaging 0.80
R2111:Itpr1 UTSW 6 108378309 unclassified probably benign
R2166:Itpr1 UTSW 6 108388225 missense probably damaging 1.00
R2272:Itpr1 UTSW 6 108493755 missense probably damaging 1.00
R2484:Itpr1 UTSW 6 108369110 missense probably damaging 1.00
R3115:Itpr1 UTSW 6 108406109 missense possibly damaging 0.55
R3751:Itpr1 UTSW 6 108349680 missense probably damaging 1.00
R3798:Itpr1 UTSW 6 108381270 missense probably damaging 1.00
R3930:Itpr1 UTSW 6 108394841 missense probably benign
R4081:Itpr1 UTSW 6 108391835 missense probably damaging 1.00
R4119:Itpr1 UTSW 6 108394355 missense probably benign
R4406:Itpr1 UTSW 6 108354663 missense probably damaging 1.00
R4506:Itpr1 UTSW 6 108432686 missense probably damaging 1.00
R4616:Itpr1 UTSW 6 108481223 missense probably damaging 1.00
R4655:Itpr1 UTSW 6 108481293 missense probably damaging 1.00
R4661:Itpr1 UTSW 6 108410931 critical splice donor site probably null
R4760:Itpr1 UTSW 6 108349632 missense probably benign 0.29
R4857:Itpr1 UTSW 6 108410867 missense probably benign 0.00
R4876:Itpr1 UTSW 6 108482906 missense probably damaging 0.97
R4939:Itpr1 UTSW 6 108440558 nonsense probably null
R5076:Itpr1 UTSW 6 108405529 splice site probably null
R5088:Itpr1 UTSW 6 108389387 missense probably damaging 1.00
R5248:Itpr1 UTSW 6 108542062 missense probably damaging 1.00
R5290:Itpr1 UTSW 6 108406145 missense possibly damaging 0.95
R5308:Itpr1 UTSW 6 108356511 missense probably damaging 1.00
R5339:Itpr1 UTSW 6 108393961 missense probably damaging 1.00
R5368:Itpr1 UTSW 6 108387498 missense probably damaging 1.00
R5369:Itpr1 UTSW 6 108519424 missense probably damaging 0.99
R5419:Itpr1 UTSW 6 108493794 missense possibly damaging 0.95
R5615:Itpr1 UTSW 6 108488600 missense possibly damaging 0.71
R5779:Itpr1 UTSW 6 108352143 missense probably damaging 1.00
R5781:Itpr1 UTSW 6 108510738 missense probably benign 0.23
R5869:Itpr1 UTSW 6 108473529 missense probably benign 0.30
R5903:Itpr1 UTSW 6 108489797 intron probably benign
R5929:Itpr1 UTSW 6 108423336 missense probably benign
R5956:Itpr1 UTSW 6 108506027 missense probably benign 0.25
R6160:Itpr1 UTSW 6 108518755 missense probably benign 0.06
R6163:Itpr1 UTSW 6 108388284 missense probably damaging 1.00
R6169:Itpr1 UTSW 6 108369116 missense probably damaging 1.00
R6237:Itpr1 UTSW 6 108378203 missense possibly damaging 0.53
R6398:Itpr1 UTSW 6 108505903 missense probably damaging 0.96
R6455:Itpr1 UTSW 6 108417972 missense probably damaging 1.00
R6522:Itpr1 UTSW 6 108388276 missense probably damaging 1.00
R6524:Itpr1 UTSW 6 108363683 missense probably damaging 1.00
R6650:Itpr1 UTSW 6 108394073 splice site probably null
R6806:Itpr1 UTSW 6 108515947 missense probably benign
R6838:Itpr1 UTSW 6 108471191 missense possibly damaging 0.87
R6841:Itpr1 UTSW 6 108388192 missense probably damaging 1.00
R6896:Itpr1 UTSW 6 108481394 missense probably damaging 1.00
R7014:Itpr1 UTSW 6 108431498 critical splice donor site probably null
R7076:Itpr1 UTSW 6 108388296 missense probably benign
R7116:Itpr1 UTSW 6 108481268 missense probably damaging 0.99
R7152:Itpr1 UTSW 6 108394407 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TAGGCAGTAACGTGATGAGGTC -3'
(R):5'- ACGAGTTCTGAGATGGCAGAC -3'

Sequencing Primer
(F):5'- CAGTAACGTGATGAGGTCTATCC -3'
(R):5'- GTTCTGAGATGGCAGACTAGAC -3'
Posted On2016-03-01