Incidental Mutation 'R4836:Frem3'
ID373245
Institutional Source Beutler Lab
Gene Symbol Frem3
Ensembl Gene ENSMUSG00000042353
Gene NameFras1 related extracellular matrix protein 3
SynonymsLOC333315
MMRRC Submission 042451-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.086) question?
Stock #R4836 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location80611080-80695356 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 80663397 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Tyrosine at position 1759 (F1759Y)
Ref Sequence ENSEMBL: ENSMUSP00000038015 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039695]
Predicted Effect probably damaging
Transcript: ENSMUST00000039695
AA Change: F1759Y

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000038015
Gene: ENSMUSG00000042353
AA Change: F1759Y

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
Pfam:Cadherin_3 369 515 9.5e-31 PFAM
Pfam:Cadherin_3 495 596 9.4e-20 PFAM
Pfam:Cadherin_3 637 786 4.2e-20 PFAM
Pfam:Cadherin_3 788 913 5.5e-23 PFAM
Pfam:Cadherin_3 998 1163 1.8e-20 PFAM
Pfam:Cadherin_3 1129 1254 1.3e-19 PFAM
Pfam:Cadherin_3 1250 1395 9.5e-34 PFAM
Pfam:Cadherin_3 1397 1508 2.7e-21 PFAM
Pfam:Cadherin_3 1493 1617 1.2e-27 PFAM
Pfam:Cadherin_3 1622 1748 4.8e-17 PFAM
Calx_beta 1754 1853 1.45e-7 SMART
Calx_beta 1866 1977 3.35e-12 SMART
Calx_beta 1991 2098 1.61e-5 SMART
Meta Mutation Damage Score 0.268 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.2%
Validation Efficiency 98% (87/89)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an integral membrane protein containing numerous CSPG (chondroitin sulfate proteoglycan element) repeats and Calx-beta domains. The protein belongs to the family of FRAS1/FREM extracellular matrix proteins and may play a role cell adhesion. [provided by RefSeq, Feb 2017]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5830411N06Rik T C 7: 140,299,108 I1051T probably benign Het
Acox1 A T 11: 116,175,326 S453T probably benign Het
AF366264 C T 8: 13,838,007 S28N probably benign Het
Ahnak2 A T 12: 112,774,116 V368D probably damaging Het
Ankrd53 A T 6: 83,768,152 Y448F probably damaging Het
Arhgef15 A T 11: 68,949,925 probably benign Het
Atg2b T C 12: 105,646,814 N1166S probably benign Het
Atl3 C T 19: 7,509,545 R77* probably null Het
Bend6 T C 1: 33,883,573 probably benign Het
Ccnt1 C A 15: 98,567,563 R25L probably damaging Het
Cct4 A G 11: 23,002,898 T525A probably benign Het
Cep350 T C 1: 155,928,833 I835V probably damaging Het
Clcn1 G T 6: 42,309,964 V652L probably damaging Het
Cntln T A 4: 85,049,720 Y725* probably null Het
Cog5 T C 12: 31,919,733 F21L probably benign Het
D6Ertd527e GGCAGCAGCAGCA GGCAGCAGCAGCAGCA 6: 87,111,424 probably benign Het
Dnm2 A T 9: 21,491,330 probably benign Het
Dnmt1 C T 9: 20,908,558 V1430I probably damaging Het
Dpep1 A G 8: 123,200,367 D285G probably damaging Het
Eef2kmt C T 16: 5,249,003 V129M probably damaging Het
Epha3 A T 16: 63,583,557 M726K probably damaging Het
Fat3 A G 9: 16,377,723 L168P probably damaging Het
Fubp3 T A 2: 31,608,141 S56R possibly damaging Het
Gm1965 T C 6: 89,145,410 noncoding transcript Het
Gm5592 C T 7: 41,215,534 probably benign Het
Hils1 T A 11: 94,968,017 L46* probably null Het
Irs1 TGGGGTGGACATCGAACTGAAGGAG TG 1: 82,287,732 probably null Het
Isl1 A G 13: 116,303,083 M243T probably benign Het
Itpr1 A T 6: 108,389,537 I142F probably damaging Het
Jak1 T C 4: 101,155,066 T1069A probably damaging Het
Jmjd1c T C 10: 67,233,446 V1848A probably benign Het
Kdm5a T C 6: 120,412,402 V930A probably damaging Het
Kdm5b C A 1: 134,593,315 probably null Het
Lexm T A 4: 106,610,527 probably null Het
Lilra5 T C 7: 4,238,714 F171L possibly damaging Het
Map1b A G 13: 99,431,054 S1720P unknown Het
Mcpt1 A T 14: 56,019,560 Q185L probably damaging Het
Mmp20 T A 9: 7,644,026 D238E possibly damaging Het
Mov10l1 A T 15: 89,020,269 I784F possibly damaging Het
Mroh2b C T 15: 4,904,270 P101S probably damaging Het
Myh3 G T 11: 67,096,939 A1413S probably benign Het
Nat6 A T 9: 107,583,539 Y211F probably damaging Het
Npdc1 G A 2: 25,408,945 D284N probably damaging Het
Olfr1009 A G 2: 85,721,449 I15V probably benign Het
Olfr1054 A T 2: 86,333,227 M43K probably benign Het
Olfr1056 G A 2: 86,355,750 L211F probably benign Het
Olfr1196 A G 2: 88,701,200 I43T probably damaging Het
Olfr330 A C 11: 58,529,482 M168R probably damaging Het
Olfr533 A G 7: 140,467,076 R292G probably damaging Het
Palld T A 8: 61,687,381 T531S probably benign Het
Parp4 A G 14: 56,585,738 E105G probably benign Het
Phf11a A T 14: 59,287,579 S59T probably damaging Het
Ppp1r12b G T 1: 134,955,733 A17E probably benign Het
Rad50 A T 11: 53,650,653 I1252N probably damaging Het
Ramp3 A G 11: 6,674,761 probably null Het
Rrbp1 G A 2: 143,988,417 T610I possibly damaging Het
Slc4a10 A G 2: 62,268,187 Y555C probably damaging Het
Slc5a2 A G 7: 128,267,505 probably null Het
Smoc1 T A 12: 81,179,548 D371E probably damaging Het
Stmn1 T A 4: 134,470,184 probably benign Het
Sulf1 C T 1: 12,842,686 L715F probably benign Het
Surf1 T C 2: 26,914,243 T180A possibly damaging Het
Syne2 A G 12: 75,979,819 I3474V probably damaging Het
Tchh A T 3: 93,445,148 R632W unknown Het
Tchh A T 3: 93,447,588 D1445V unknown Het
Tctn1 A T 5: 122,245,505 M505K probably benign Het
Tdrkh T A 3: 94,425,590 I150N probably damaging Het
Tespa1 C T 10: 130,362,159 T350I probably benign Het
Thbs1 A G 2: 118,115,018 Y326C possibly damaging Het
Tmem208 C T 8: 105,328,664 S119F probably damaging Het
Tmprss6 G C 15: 78,445,388 A91G probably damaging Het
Trp53bp2 C T 1: 182,431,582 R67W probably damaging Het
Ttn A G 2: 76,711,197 I25488T possibly damaging Het
Txnl4a A G 18: 80,222,253 E111G probably damaging Het
Unc13b T G 4: 43,237,137 I3402M probably damaging Het
Vmn1r188 A C 13: 22,088,121 I82L probably benign Het
Zfp65 A G 13: 67,708,875 V95A probably benign Het
Zfp985 T A 4: 147,584,155 S493R probably damaging Het
Other mutations in Frem3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00481:Frem3 APN 8 80668810 missense possibly damaging 0.75
IGL01019:Frem3 APN 8 80615134 missense probably benign 0.02
IGL01470:Frem3 APN 8 80614315 missense probably damaging 1.00
IGL01609:Frem3 APN 8 80612704 missense probably benign 0.00
IGL01622:Frem3 APN 8 80613915 missense probably benign 0.01
IGL01623:Frem3 APN 8 80613915 missense probably benign 0.01
IGL01751:Frem3 APN 8 80615743 missense probably benign 0.33
IGL02037:Frem3 APN 8 80611489 missense probably benign 0.31
IGL02039:Frem3 APN 8 80612971 missense probably damaging 1.00
IGL02084:Frem3 APN 8 80612443 missense possibly damaging 0.95
IGL02124:Frem3 APN 8 80613094 missense probably damaging 0.99
IGL02140:Frem3 APN 8 80614107 missense possibly damaging 0.84
IGL02836:Frem3 APN 8 80614381 missense probably benign
IGL03090:Frem3 APN 8 80618229 missense probably benign 0.01
IGL03102:Frem3 APN 8 80613032 missense possibly damaging 0.92
IGL03116:Frem3 APN 8 80612806 missense possibly damaging 0.84
IGL03165:Frem3 APN 8 80612529 missense probably benign 0.26
IGL03224:Frem3 APN 8 80613463 missense probably damaging 1.00
IGL03401:Frem3 APN 8 80614541 missense probably damaging 1.00
IGL03403:Frem3 APN 8 80611090 missense probably benign 0.04
FR4340:Frem3 UTSW 8 80615241 small insertion probably benign
FR4976:Frem3 UTSW 8 80615241 small insertion probably benign
IGL02991:Frem3 UTSW 8 80668882 missense probably damaging 1.00
IGL03052:Frem3 UTSW 8 80614530 missense probably damaging 1.00
R0089:Frem3 UTSW 8 80615878 missense possibly damaging 0.94
R0647:Frem3 UTSW 8 80615185 missense probably damaging 1.00
R0690:Frem3 UTSW 8 80613952 missense possibly damaging 0.84
R0766:Frem3 UTSW 8 80615322 missense probably benign
R0834:Frem3 UTSW 8 80687008 missense probably damaging 1.00
R0909:Frem3 UTSW 8 80663406 missense probably benign 0.45
R1033:Frem3 UTSW 8 80695157 missense probably benign 0.00
R1144:Frem3 UTSW 8 80611884 missense probably benign 0.01
R1312:Frem3 UTSW 8 80615322 missense probably benign
R1330:Frem3 UTSW 8 80668839 missense probably damaging 0.99
R1355:Frem3 UTSW 8 80690702 missense probably damaging 1.00
R1390:Frem3 UTSW 8 80690773 missense probably damaging 0.99
R1413:Frem3 UTSW 8 80668801 missense probably benign
R1470:Frem3 UTSW 8 80611191 missense probably benign 0.05
R1470:Frem3 UTSW 8 80611191 missense probably benign 0.05
R1503:Frem3 UTSW 8 80687018 missense probably damaging 0.99
R1538:Frem3 UTSW 8 80612710 missense probably damaging 1.00
R1538:Frem3 UTSW 8 80613135 missense probably benign 0.00
R1612:Frem3 UTSW 8 80614861 missense probably damaging 1.00
R1793:Frem3 UTSW 8 80613112 missense probably benign 0.03
R1872:Frem3 UTSW 8 80612576 missense probably damaging 1.00
R1879:Frem3 UTSW 8 80611938 nonsense probably null
R1886:Frem3 UTSW 8 80613885 missense probably benign 0.00
R1933:Frem3 UTSW 8 80612890 missense probably benign 0.00
R2027:Frem3 UTSW 8 80695337 missense possibly damaging 0.75
R2040:Frem3 UTSW 8 80615826 missense possibly damaging 0.92
R2050:Frem3 UTSW 8 80614891 missense probably damaging 1.00
R2079:Frem3 UTSW 8 80615103 missense probably benign 0.03
R2099:Frem3 UTSW 8 80615859 missense probably benign 0.06
R2120:Frem3 UTSW 8 80615457 missense probably benign 0.20
R2842:Frem3 UTSW 8 80669349 intron probably null
R2845:Frem3 UTSW 8 80613220 missense probably damaging 1.00
R3015:Frem3 UTSW 8 80690773 missense probably damaging 0.99
R3442:Frem3 UTSW 8 80613040 missense probably damaging 1.00
R3724:Frem3 UTSW 8 80615271 missense probably benign 0.06
R3730:Frem3 UTSW 8 80615916 missense probably damaging 0.99
R3939:Frem3 UTSW 8 80615020 missense possibly damaging 0.84
R3940:Frem3 UTSW 8 80615020 missense possibly damaging 0.84
R3941:Frem3 UTSW 8 80615020 missense possibly damaging 0.84
R4089:Frem3 UTSW 8 80615173 missense probably damaging 1.00
R4282:Frem3 UTSW 8 80614141 missense probably benign 0.00
R4437:Frem3 UTSW 8 80612607 missense probably benign 0.30
R4480:Frem3 UTSW 8 80611357 missense probably benign 0.10
R4575:Frem3 UTSW 8 80616075 missense probably benign 0.17
R4583:Frem3 UTSW 8 80613514 missense probably benign 0.03
R4620:Frem3 UTSW 8 80668957 missense possibly damaging 0.82
R4621:Frem3 UTSW 8 80669191 splice site probably null
R4644:Frem3 UTSW 8 80613727 missense probably benign 0.33
R4667:Frem3 UTSW 8 80663420 missense probably damaging 0.97
R4748:Frem3 UTSW 8 80611459 missense probably damaging 1.00
R4823:Frem3 UTSW 8 80613958 missense probably benign 0.25
R4867:Frem3 UTSW 8 80613283 missense probably damaging 1.00
R4921:Frem3 UTSW 8 80613136 missense possibly damaging 0.83
R5030:Frem3 UTSW 8 80613247 missense possibly damaging 0.89
R5035:Frem3 UTSW 8 80615914 missense probably damaging 0.97
R5172:Frem3 UTSW 8 80612566 missense probably benign 0.44
R5289:Frem3 UTSW 8 80612319 missense probably benign 0.00
R5492:Frem3 UTSW 8 80612677 missense probably damaging 1.00
R5655:Frem3 UTSW 8 80612694 missense probably benign 0.00
R5685:Frem3 UTSW 8 80695303 missense probably damaging 1.00
R5723:Frem3 UTSW 8 80613397 missense probably benign 0.02
R5743:Frem3 UTSW 8 80615778 missense probably damaging 0.98
R5889:Frem3 UTSW 8 80614288 missense probably damaging 1.00
R6048:Frem3 UTSW 8 80613433 missense probably benign 0.03
R6057:Frem3 UTSW 8 80615587 missense probably damaging 0.99
R6137:Frem3 UTSW 8 80615047 missense probably benign
R6264:Frem3 UTSW 8 80615203 missense probably damaging 1.00
R6339:Frem3 UTSW 8 80613015 missense possibly damaging 0.84
R6418:Frem3 UTSW 8 80611152 missense probably benign 0.08
R6680:Frem3 UTSW 8 80669320 missense probably damaging 1.00
R6773:Frem3 UTSW 8 80611815 missense probably damaging 1.00
R6838:Frem3 UTSW 8 80612031 missense probably damaging 1.00
R6928:Frem3 UTSW 8 80611282 missense possibly damaging 0.48
R6939:Frem3 UTSW 8 80615145 missense probably benign 0.23
R6995:Frem3 UTSW 8 80612579 missense probably damaging 0.98
R7112:Frem3 UTSW 8 80612031 missense probably damaging 1.00
R7155:Frem3 UTSW 8 80616039 missense probably benign 0.01
R7235:Frem3 UTSW 8 80690725 missense probably benign 0.00
R7282:Frem3 UTSW 8 80612031 missense probably damaging 1.00
X0024:Frem3 UTSW 8 80613081 missense possibly damaging 0.76
X0027:Frem3 UTSW 8 80612388 nonsense probably null
Z1088:Frem3 UTSW 8 80615426 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- TGACCACCGATTTGTAGTATTCTTC -3'
(R):5'- ATTCCATCAGTCCAGCCATC -3'

Sequencing Primer
(F):5'- GATTTGTAGTATTCTTCCCCTAAGC -3'
(R):5'- TCTCACGGCTGTCTGAAGC -3'
Posted On2016-03-01