Incidental Mutation 'R4836:Mroh2b'
Institutional Source Beutler Lab
Gene Symbol Mroh2b
Ensembl Gene ENSMUSG00000022155
Gene Namemaestro heat-like repeat family member 2B
Synonyms4930455B06Rik, Heatr7b2
MMRRC Submission 042451-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.165) question?
Stock #R4836 (G1)
Quality Score225
Status Validated
Chromosomal Location4898737-4962205 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 4904270 bp
Amino Acid Change Proline to Serine at position 101 (P101S)
Ref Sequence ENSEMBL: ENSMUSP00000036148 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045736]
Predicted Effect probably damaging
Transcript: ENSMUST00000045736
AA Change: P101S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000036148
Gene: ENSMUSG00000022155
AA Change: P101S

low complexity region 124 135 N/A INTRINSIC
low complexity region 824 842 N/A INTRINSIC
SCOP:d1gw5a_ 937 1443 7e-15 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226277
Meta Mutation Damage Score 0.16 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.2%
Validation Efficiency 98% (87/89)
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5830411N06Rik T C 7: 140,299,108 I1051T probably benign Het
Acox1 A T 11: 116,175,326 S453T probably benign Het
AF366264 C T 8: 13,838,007 S28N probably benign Het
Ahnak2 A T 12: 112,774,116 V368D probably damaging Het
Ankrd53 A T 6: 83,768,152 Y448F probably damaging Het
Arhgef15 A T 11: 68,949,925 probably benign Het
Atg2b T C 12: 105,646,814 N1166S probably benign Het
Atl3 C T 19: 7,509,545 R77* probably null Het
Bend6 T C 1: 33,883,573 probably benign Het
Ccnt1 C A 15: 98,567,563 R25L probably damaging Het
Cct4 A G 11: 23,002,898 T525A probably benign Het
Cep350 T C 1: 155,928,833 I835V probably damaging Het
Clcn1 G T 6: 42,309,964 V652L probably damaging Het
Cntln T A 4: 85,049,720 Y725* probably null Het
Cog5 T C 12: 31,919,733 F21L probably benign Het
D6Ertd527e GGCAGCAGCAGCA GGCAGCAGCAGCAGCA 6: 87,111,424 probably benign Het
Dnm2 A T 9: 21,491,330 probably benign Het
Dnmt1 C T 9: 20,908,558 V1430I probably damaging Het
Dpep1 A G 8: 123,200,367 D285G probably damaging Het
Eef2kmt C T 16: 5,249,003 V129M probably damaging Het
Epha3 A T 16: 63,583,557 M726K probably damaging Het
Fat3 A G 9: 16,377,723 L168P probably damaging Het
Frem3 T A 8: 80,663,397 F1759Y probably damaging Het
Fubp3 T A 2: 31,608,141 S56R possibly damaging Het
Gm1965 T C 6: 89,145,410 noncoding transcript Het
Gm5592 C T 7: 41,215,534 probably benign Het
Hils1 T A 11: 94,968,017 L46* probably null Het
Irs1 TGGGGTGGACATCGAACTGAAGGAG TG 1: 82,287,732 probably null Het
Isl1 A G 13: 116,303,083 M243T probably benign Het
Itpr1 A T 6: 108,389,537 I142F probably damaging Het
Jak1 T C 4: 101,155,066 T1069A probably damaging Het
Jmjd1c T C 10: 67,233,446 V1848A probably benign Het
Kdm5a T C 6: 120,412,402 V930A probably damaging Het
Kdm5b C A 1: 134,593,315 probably null Het
Lexm T A 4: 106,610,527 probably null Het
Lilra5 T C 7: 4,238,714 F171L possibly damaging Het
Map1b A G 13: 99,431,054 S1720P unknown Het
Mcpt1 A T 14: 56,019,560 Q185L probably damaging Het
Mmp20 T A 9: 7,644,026 D238E possibly damaging Het
Mov10l1 A T 15: 89,020,269 I784F possibly damaging Het
Myh3 G T 11: 67,096,939 A1413S probably benign Het
Nat6 A T 9: 107,583,539 Y211F probably damaging Het
Npdc1 G A 2: 25,408,945 D284N probably damaging Het
Olfr1009 A G 2: 85,721,449 I15V probably benign Het
Olfr1054 A T 2: 86,333,227 M43K probably benign Het
Olfr1056 G A 2: 86,355,750 L211F probably benign Het
Olfr1196 A G 2: 88,701,200 I43T probably damaging Het
Olfr330 A C 11: 58,529,482 M168R probably damaging Het
Olfr533 A G 7: 140,467,076 R292G probably damaging Het
Palld T A 8: 61,687,381 T531S probably benign Het
Parp4 A G 14: 56,585,738 E105G probably benign Het
Phf11a A T 14: 59,287,579 S59T probably damaging Het
Ppp1r12b G T 1: 134,955,733 A17E probably benign Het
Rad50 A T 11: 53,650,653 I1252N probably damaging Het
Ramp3 A G 11: 6,674,761 probably null Het
Rrbp1 G A 2: 143,988,417 T610I possibly damaging Het
Slc4a10 A G 2: 62,268,187 Y555C probably damaging Het
Slc5a2 A G 7: 128,267,505 probably null Het
Smoc1 T A 12: 81,179,548 D371E probably damaging Het
Stmn1 T A 4: 134,470,184 probably benign Het
Sulf1 C T 1: 12,842,686 L715F probably benign Het
Surf1 T C 2: 26,914,243 T180A possibly damaging Het
Syne2 A G 12: 75,979,819 I3474V probably damaging Het
Tchh A T 3: 93,445,148 R632W unknown Het
Tchh A T 3: 93,447,588 D1445V unknown Het
Tctn1 A T 5: 122,245,505 M505K probably benign Het
Tdrkh T A 3: 94,425,590 I150N probably damaging Het
Tespa1 C T 10: 130,362,159 T350I probably benign Het
Thbs1 A G 2: 118,115,018 Y326C possibly damaging Het
Tmem208 C T 8: 105,328,664 S119F probably damaging Het
Tmprss6 G C 15: 78,445,388 A91G probably damaging Het
Trp53bp2 C T 1: 182,431,582 R67W probably damaging Het
Ttn A G 2: 76,711,197 I25488T possibly damaging Het
Txnl4a A G 18: 80,222,253 E111G probably damaging Het
Unc13b T G 4: 43,237,137 I3402M probably damaging Het
Vmn1r188 A C 13: 22,088,121 I82L probably benign Het
Zfp65 A G 13: 67,708,875 V95A probably benign Het
Zfp985 T A 4: 147,584,155 S493R probably damaging Het
Other mutations in Mroh2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00503:Mroh2b APN 15 4899197 missense probably benign
IGL00507:Mroh2b APN 15 4962127 missense probably damaging 1.00
IGL00548:Mroh2b APN 15 4931316 missense probably benign 0.35
IGL00902:Mroh2b APN 15 4915222 missense probably damaging 1.00
IGL00944:Mroh2b APN 15 4951127 splice site probably benign
IGL00954:Mroh2b APN 15 4903054 missense probably damaging 0.99
IGL01015:Mroh2b APN 15 4941542 missense probably damaging 1.00
IGL01134:Mroh2b APN 15 4915152 missense probably benign 0.00
IGL01337:Mroh2b APN 15 4905024 missense probably benign 0.38
IGL01780:Mroh2b APN 15 4912000 missense probably benign 0.01
IGL01919:Mroh2b APN 15 4923688 missense probably benign 0.10
IGL02069:Mroh2b APN 15 4904324 splice site probably benign
IGL02146:Mroh2b APN 15 4951294 splice site probably null
IGL02221:Mroh2b APN 15 4923641 missense probably damaging 1.00
IGL02281:Mroh2b APN 15 4952263 missense probably benign 0.04
IGL02350:Mroh2b APN 15 4912000 missense probably benign 0.01
IGL02357:Mroh2b APN 15 4912000 missense probably benign 0.01
IGL02401:Mroh2b APN 15 4900501 missense possibly damaging 0.71
IGL02427:Mroh2b APN 15 4951560 splice site probably benign
IGL02432:Mroh2b APN 15 4914186 missense probably benign
IGL02582:Mroh2b APN 15 4908515 missense probably damaging 0.98
IGL02632:Mroh2b APN 15 4931101 missense probably damaging 0.99
IGL02741:Mroh2b APN 15 4905632 missense probably benign
IGL02811:Mroh2b APN 15 4915236 missense possibly damaging 0.55
IGL02826:Mroh2b APN 15 4962148 missense probably damaging 0.99
IGL03412:Mroh2b APN 15 4944372 missense probably benign 0.14
PIT4468001:Mroh2b UTSW 15 4912812 missense probably damaging 1.00
R0024:Mroh2b UTSW 15 4925627 missense probably damaging 1.00
R0333:Mroh2b UTSW 15 4931118 missense probably damaging 1.00
R0433:Mroh2b UTSW 15 4941634 missense probably benign 0.01
R0530:Mroh2b UTSW 15 4934395 missense probably damaging 0.97
R1411:Mroh2b UTSW 15 4918317 missense probably damaging 1.00
R1457:Mroh2b UTSW 15 4925684 missense probably damaging 1.00
R1466:Mroh2b UTSW 15 4925684 missense probably damaging 1.00
R1466:Mroh2b UTSW 15 4925684 missense probably damaging 1.00
R1472:Mroh2b UTSW 15 4948655 missense probably benign 0.00
R1525:Mroh2b UTSW 15 4951130 splice site probably null
R1584:Mroh2b UTSW 15 4925684 missense probably damaging 1.00
R1605:Mroh2b UTSW 15 4945090 missense probably benign 0.08
R1657:Mroh2b UTSW 15 4931043 nonsense probably null
R1671:Mroh2b UTSW 15 4951294 splice site probably null
R1698:Mroh2b UTSW 15 4914140 missense probably benign 0.02
R2002:Mroh2b UTSW 15 4925684 missense probably damaging 1.00
R2005:Mroh2b UTSW 15 4917158 missense probably damaging 1.00
R2077:Mroh2b UTSW 15 4944966 missense probably damaging 1.00
R2179:Mroh2b UTSW 15 4921446 critical splice donor site probably null
R2183:Mroh2b UTSW 15 4918225 splice site probably null
R3713:Mroh2b UTSW 15 4943649 missense probably benign 0.01
R3714:Mroh2b UTSW 15 4943649 missense probably benign 0.01
R3747:Mroh2b UTSW 15 4952246 nonsense probably null
R3748:Mroh2b UTSW 15 4952246 nonsense probably null
R3749:Mroh2b UTSW 15 4952246 nonsense probably null
R3750:Mroh2b UTSW 15 4952246 nonsense probably null
R3792:Mroh2b UTSW 15 4923620 missense probably damaging 1.00
R3872:Mroh2b UTSW 15 4925061 nonsense probably null
R4021:Mroh2b UTSW 15 4925100 missense possibly damaging 0.75
R4329:Mroh2b UTSW 15 4931379 missense probably damaging 0.99
R4456:Mroh2b UTSW 15 4947925 missense probably benign 0.21
R4592:Mroh2b UTSW 15 4918290 missense probably damaging 1.00
R5050:Mroh2b UTSW 15 4900450 missense possibly damaging 0.82
R5230:Mroh2b UTSW 15 4941522 missense probably benign 0.07
R5342:Mroh2b UTSW 15 4914133 nonsense probably null
R5353:Mroh2b UTSW 15 4917178 missense probably damaging 1.00
R5368:Mroh2b UTSW 15 4905572 missense probably damaging 1.00
R5424:Mroh2b UTSW 15 4941612 missense probably damaging 0.98
R5484:Mroh2b UTSW 15 4908981 missense possibly damaging 0.92
R5999:Mroh2b UTSW 15 4912884 intron probably null
R6046:Mroh2b UTSW 15 4951281 missense probably benign 0.01
R6081:Mroh2b UTSW 15 4944377 missense probably damaging 1.00
R6162:Mroh2b UTSW 15 4915225 missense probably damaging 1.00
R6165:Mroh2b UTSW 15 4918350 missense probably benign 0.23
R6240:Mroh2b UTSW 15 4934644 missense probably benign 0.38
R6487:Mroh2b UTSW 15 4947239 missense probably damaging 1.00
R6539:Mroh2b UTSW 15 4905574 missense probably damaging 1.00
R6616:Mroh2b UTSW 15 4953282 missense probably benign 0.36
R6663:Mroh2b UTSW 15 4947935 missense probably benign 0.21
R6820:Mroh2b UTSW 15 4953274 missense probably damaging 1.00
R6900:Mroh2b UTSW 15 4908987 missense probably benign 0.00
R6990:Mroh2b UTSW 15 4912802 missense possibly damaging 0.55
R7067:Mroh2b UTSW 15 4900504 missense probably benign 0.35
R7092:Mroh2b UTSW 15 4934678 missense possibly damaging 0.92
R7102:Mroh2b UTSW 15 4948003 missense probably benign 0.06
X0067:Mroh2b UTSW 15 4951591 missense possibly damaging 0.90
Predicted Primers PCR Primer

Sequencing Primer
Posted On2016-03-01