Incidental Mutation 'R4836:Mov10l1'
Institutional Source Beutler Lab
Gene Symbol Mov10l1
Ensembl Gene ENSMUSG00000015365
Gene NameMoloney leukemia virus 10-like 1
SynonymsCsm, CHAMP
MMRRC Submission 042451-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.496) question?
Stock #R4836 (G1)
Quality Score225
Status Validated
Chromosomal Location88982909-89055152 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 89020269 bp
Amino Acid Change Isoleucine to Phenylalanine at position 784 (I784F)
Ref Sequence ENSEMBL: ENSMUSP00000118437 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000015509] [ENSMUST00000146993]
Predicted Effect probably benign
Transcript: ENSMUST00000015509
AA Change: I732F

PolyPhen 2 Score 0.202 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000015509
Gene: ENSMUSG00000015365
AA Change: I732F

low complexity region 52 65 N/A INTRINSIC
low complexity region 338 349 N/A INTRINSIC
Blast:AAA 444 526 2e-7 BLAST
internal_repeat_1 615 651 5.23e-10 PROSPERO
internal_repeat_1 648 696 5.23e-10 PROSPERO
Pfam:AAA_11 746 852 1.4e-17 PFAM
Pfam:AAA_30 746 933 5e-11 PFAM
Pfam:AAA_19 754 826 1.5e-10 PFAM
Pfam:AAA_11 855 928 1.3e-18 PFAM
Pfam:AAA_12 935 1152 3.7e-44 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000082547
Predicted Effect probably benign
Transcript: ENSMUST00000143030
SMART Domains Protein: ENSMUSP00000134200
Gene: ENSMUSG00000015365

Pfam:AAA_11 2 51 1e-14 PFAM
Pfam:AAA_12 58 275 5.2e-45 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000146993
AA Change: I784F

PolyPhen 2 Score 0.472 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000118437
Gene: ENSMUSG00000015365
AA Change: I784F

low complexity region 104 117 N/A INTRINSIC
low complexity region 390 401 N/A INTRINSIC
Blast:AAA 496 578 2e-7 BLAST
internal_repeat_1 667 703 6.08e-10 PROSPERO
internal_repeat_1 700 748 6.08e-10 PROSPERO
Pfam:AAA_11 798 903 1e-15 PFAM
Pfam:AAA_30 798 985 1.8e-11 PFAM
Pfam:AAA_19 806 878 7e-11 PFAM
Pfam:AAA_11 907 980 3.2e-17 PFAM
Pfam:AAA_12 987 1204 1.4e-43 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148198
Meta Mutation Damage Score 0.174 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.2%
Validation Efficiency 98% (87/89)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is similar to a mouse gene that encodes a putative RNA helicase and shows testis-specific expression. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2009]
PHENOTYPE: Mice homozygous for a targeted allele lacking the helicase domain exhibit male infertility due to meiotic arrest, apoptosis, and derepression of retrotransposons in male germ cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5830411N06Rik T C 7: 140,299,108 I1051T probably benign Het
Acox1 A T 11: 116,175,326 S453T probably benign Het
AF366264 C T 8: 13,838,007 S28N probably benign Het
Ahnak2 A T 12: 112,774,116 V368D probably damaging Het
Ankrd53 A T 6: 83,768,152 Y448F probably damaging Het
Arhgef15 A T 11: 68,949,925 probably benign Het
Atg2b T C 12: 105,646,814 N1166S probably benign Het
Atl3 C T 19: 7,509,545 R77* probably null Het
Bend6 T C 1: 33,883,573 probably benign Het
Ccnt1 C A 15: 98,567,563 R25L probably damaging Het
Cct4 A G 11: 23,002,898 T525A probably benign Het
Cep350 T C 1: 155,928,833 I835V probably damaging Het
Clcn1 G T 6: 42,309,964 V652L probably damaging Het
Cntln T A 4: 85,049,720 Y725* probably null Het
Cog5 T C 12: 31,919,733 F21L probably benign Het
D6Ertd527e GGCAGCAGCAGCA GGCAGCAGCAGCAGCA 6: 87,111,424 probably benign Het
Dnm2 A T 9: 21,491,330 probably benign Het
Dnmt1 C T 9: 20,908,558 V1430I probably damaging Het
Dpep1 A G 8: 123,200,367 D285G probably damaging Het
Eef2kmt C T 16: 5,249,003 V129M probably damaging Het
Epha3 A T 16: 63,583,557 M726K probably damaging Het
Fat3 A G 9: 16,377,723 L168P probably damaging Het
Frem3 T A 8: 80,663,397 F1759Y probably damaging Het
Fubp3 T A 2: 31,608,141 S56R possibly damaging Het
Gm1965 T C 6: 89,145,410 noncoding transcript Het
Gm5592 C T 7: 41,215,534 probably benign Het
Hils1 T A 11: 94,968,017 L46* probably null Het
Irs1 TGGGGTGGACATCGAACTGAAGGAG TG 1: 82,287,732 probably null Het
Isl1 A G 13: 116,303,083 M243T probably benign Het
Itpr1 A T 6: 108,389,537 I142F probably damaging Het
Jak1 T C 4: 101,155,066 T1069A probably damaging Het
Jmjd1c T C 10: 67,233,446 V1848A probably benign Het
Kdm5a T C 6: 120,412,402 V930A probably damaging Het
Kdm5b C A 1: 134,593,315 probably null Het
Lexm T A 4: 106,610,527 probably null Het
Lilra5 T C 7: 4,238,714 F171L possibly damaging Het
Map1b A G 13: 99,431,054 S1720P unknown Het
Mcpt1 A T 14: 56,019,560 Q185L probably damaging Het
Mmp20 T A 9: 7,644,026 D238E possibly damaging Het
Mroh2b C T 15: 4,904,270 P101S probably damaging Het
Myh3 G T 11: 67,096,939 A1413S probably benign Het
Nat6 A T 9: 107,583,539 Y211F probably damaging Het
Npdc1 G A 2: 25,408,945 D284N probably damaging Het
Olfr1009 A G 2: 85,721,449 I15V probably benign Het
Olfr1054 A T 2: 86,333,227 M43K probably benign Het
Olfr1056 G A 2: 86,355,750 L211F probably benign Het
Olfr1196 A G 2: 88,701,200 I43T probably damaging Het
Olfr330 A C 11: 58,529,482 M168R probably damaging Het
Olfr533 A G 7: 140,467,076 R292G probably damaging Het
Palld T A 8: 61,687,381 T531S probably benign Het
Parp4 A G 14: 56,585,738 E105G probably benign Het
Phf11a A T 14: 59,287,579 S59T probably damaging Het
Ppp1r12b G T 1: 134,955,733 A17E probably benign Het
Rad50 A T 11: 53,650,653 I1252N probably damaging Het
Ramp3 A G 11: 6,674,761 probably null Het
Rrbp1 G A 2: 143,988,417 T610I possibly damaging Het
Slc4a10 A G 2: 62,268,187 Y555C probably damaging Het
Slc5a2 A G 7: 128,267,505 probably null Het
Smoc1 T A 12: 81,179,548 D371E probably damaging Het
Stmn1 T A 4: 134,470,184 probably benign Het
Sulf1 C T 1: 12,842,686 L715F probably benign Het
Surf1 T C 2: 26,914,243 T180A possibly damaging Het
Syne2 A G 12: 75,979,819 I3474V probably damaging Het
Tchh A T 3: 93,445,148 R632W unknown Het
Tchh A T 3: 93,447,588 D1445V unknown Het
Tctn1 A T 5: 122,245,505 M505K probably benign Het
Tdrkh T A 3: 94,425,590 I150N probably damaging Het
Tespa1 C T 10: 130,362,159 T350I probably benign Het
Thbs1 A G 2: 118,115,018 Y326C possibly damaging Het
Tmem208 C T 8: 105,328,664 S119F probably damaging Het
Tmprss6 G C 15: 78,445,388 A91G probably damaging Het
Trp53bp2 C T 1: 182,431,582 R67W probably damaging Het
Ttn A G 2: 76,711,197 I25488T possibly damaging Het
Txnl4a A G 18: 80,222,253 E111G probably damaging Het
Unc13b T G 4: 43,237,137 I3402M probably damaging Het
Vmn1r188 A C 13: 22,088,121 I82L probably benign Het
Zfp65 A G 13: 67,708,875 V95A probably benign Het
Zfp985 T A 4: 147,584,155 S493R probably damaging Het
Other mutations in Mov10l1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00955:Mov10l1 APN 15 88994989 missense probably damaging 1.00
IGL01110:Mov10l1 APN 15 89021257 missense probably benign 0.05
IGL01369:Mov10l1 APN 15 89024837 splice site probably benign
IGL01531:Mov10l1 APN 15 89054352 missense probably damaging 0.99
IGL01712:Mov10l1 APN 15 89024766 missense probably damaging 0.98
IGL02330:Mov10l1 APN 15 89026490 missense probably damaging 1.00
IGL02540:Mov10l1 APN 15 89018211 missense probably benign
IGL02938:Mov10l1 APN 15 88988526 missense probably damaging 1.00
R0382:Mov10l1 UTSW 15 88985593 missense possibly damaging 0.96
R0437:Mov10l1 UTSW 15 89005312 missense probably damaging 0.96
R0504:Mov10l1 UTSW 15 88998839 missense probably damaging 1.00
R0538:Mov10l1 UTSW 15 88994860 missense possibly damaging 0.73
R0577:Mov10l1 UTSW 15 89005727 missense probably damaging 1.00
R0592:Mov10l1 UTSW 15 88998766 critical splice acceptor site probably null
R0972:Mov10l1 UTSW 15 89021279 missense probably damaging 0.99
R1386:Mov10l1 UTSW 15 89011386 missense possibly damaging 0.87
R1737:Mov10l1 UTSW 15 89011404 missense possibly damaging 0.79
R2120:Mov10l1 UTSW 15 89007627 missense probably benign 0.30
R3740:Mov10l1 UTSW 15 89012142 missense possibly damaging 0.92
R3741:Mov10l1 UTSW 15 89012142 missense possibly damaging 0.92
R3846:Mov10l1 UTSW 15 89012142 missense possibly damaging 0.92
R3850:Mov10l1 UTSW 15 89005695 critical splice acceptor site probably null
R3964:Mov10l1 UTSW 15 89012163 missense probably benign 0.00
R3965:Mov10l1 UTSW 15 89012163 missense probably benign 0.00
R4049:Mov10l1 UTSW 15 88995032 splice site probably benign
R5233:Mov10l1 UTSW 15 88983032 missense probably benign
R5466:Mov10l1 UTSW 15 88985701 critical splice donor site probably null
R5552:Mov10l1 UTSW 15 89054366 critical splice donor site probably null
R5780:Mov10l1 UTSW 15 89011978 missense probably benign
R6275:Mov10l1 UTSW 15 89026620 missense probably damaging 0.99
R6326:Mov10l1 UTSW 15 88994895 missense probably damaging 1.00
R6652:Mov10l1 UTSW 15 88993902 missense probably damaging 1.00
R6793:Mov10l1 UTSW 15 88996184 missense possibly damaging 0.86
Predicted Primers PCR Primer

Sequencing Primer
Posted On2016-03-01