Incidental Mutation 'R4836:Ccnt1'
ID373275
Institutional Source Beutler Lab
Gene Symbol Ccnt1
Ensembl Gene ENSMUSG00000011960
Gene Namecyclin T1
Synonyms2810478G24Rik, CycT1
MMRRC Submission 042451-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.881) question?
Stock #R4836 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location98538689-98570923 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 98567563 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Leucine at position 25 (R25L)
Ref Sequence ENSEMBL: ENSMUSP00000130286 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000012104] [ENSMUST00000023728] [ENSMUST00000168928] [ENSMUST00000169707]
Predicted Effect possibly damaging
Transcript: ENSMUST00000012104
AA Change: R25L

PolyPhen 2 Score 0.820 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000012104
Gene: ENSMUSG00000011960
AA Change: R25L

DomainStartEndE-ValueType
CYCLIN 43 142 5.89e-17 SMART
SCOP:d1jkw_2 152 257 1e-24 SMART
Blast:CYCLIN 155 243 2e-54 BLAST
low complexity region 308 326 N/A INTRINSIC
coiled coil region 388 419 N/A INTRINSIC
low complexity region 512 529 N/A INTRINSIC
low complexity region 559 570 N/A INTRINSIC
low complexity region 706 723 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000023728
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130921
Predicted Effect noncoding transcript
Transcript: ENSMUST00000163781
Predicted Effect noncoding transcript
Transcript: ENSMUST00000164294
Predicted Effect noncoding transcript
Transcript: ENSMUST00000164565
Predicted Effect probably damaging
Transcript: ENSMUST00000168928
AA Change: R25L

PolyPhen 2 Score 0.959 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000130286
Gene: ENSMUSG00000011960
AA Change: R25L

DomainStartEndE-ValueType
CYCLIN 43 142 5.89e-17 SMART
Blast:CYCLIN 155 182 3e-9 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000169707
AA Change: R25L

PolyPhen 2 Score 0.820 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000126874
Gene: ENSMUSG00000011960
AA Change: R25L

DomainStartEndE-ValueType
CYCLIN 43 142 5.89e-17 SMART
SCOP:d1jkw_2 152 257 1e-24 SMART
Blast:CYCLIN 155 243 2e-54 BLAST
low complexity region 308 326 N/A INTRINSIC
coiled coil region 388 419 N/A INTRINSIC
low complexity region 512 529 N/A INTRINSIC
low complexity region 559 570 N/A INTRINSIC
low complexity region 706 723 N/A INTRINSIC
Meta Mutation Damage Score 0.0268 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.2%
Validation Efficiency 98% (87/89)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the highly conserved cyclin C subfamily. The encoded protein tightly associates with cyclin-dependent kinase 9, and is a major subunit of positive transcription elongation factor b (p-TEFb). In humans, there are multiple forms of positive transcription elongation factor b, which may include one of several different cyclins along with cyclin-dependent kinase 9. The complex containing the encoded cyclin and cyclin-dependent kinase 9 acts as a cofactor of human immunodeficiency virus type 1 (HIV-1) Tat protein, and is both necessary and sufficient for full activation of viral transcription. This cyclin and its kinase partner are also involved in triggering transcript elongation through phosphorylation of the carboxy-terminal domain of the largest RNA polymerase II subunit. Overexpression of this gene is implicated in tumor growth. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2013]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5830411N06Rik T C 7: 140,299,108 I1051T probably benign Het
Acox1 A T 11: 116,175,326 S453T probably benign Het
AF366264 C T 8: 13,838,007 S28N probably benign Het
Ahnak2 A T 12: 112,774,116 V368D probably damaging Het
Ankrd53 A T 6: 83,768,152 Y448F probably damaging Het
Arhgef15 A T 11: 68,949,925 probably benign Het
Atg2b T C 12: 105,646,814 N1166S probably benign Het
Atl3 C T 19: 7,509,545 R77* probably null Het
Bend6 T C 1: 33,883,573 probably benign Het
Cct4 A G 11: 23,002,898 T525A probably benign Het
Cep350 T C 1: 155,928,833 I835V probably damaging Het
Clcn1 G T 6: 42,309,964 V652L probably damaging Het
Cntln T A 4: 85,049,720 Y725* probably null Het
Cog5 T C 12: 31,919,733 F21L probably benign Het
D6Ertd527e GGCAGCAGCAGCA GGCAGCAGCAGCAGCA 6: 87,111,424 probably benign Het
Dnm2 A T 9: 21,491,330 probably benign Het
Dnmt1 C T 9: 20,908,558 V1430I probably damaging Het
Dpep1 A G 8: 123,200,367 D285G probably damaging Het
Eef2kmt C T 16: 5,249,003 V129M probably damaging Het
Epha3 A T 16: 63,583,557 M726K probably damaging Het
Fat3 A G 9: 16,377,723 L168P probably damaging Het
Frem3 T A 8: 80,663,397 F1759Y probably damaging Het
Fubp3 T A 2: 31,608,141 S56R possibly damaging Het
Gm1965 T C 6: 89,145,410 noncoding transcript Het
Gm5592 C T 7: 41,215,534 probably benign Het
Hils1 T A 11: 94,968,017 L46* probably null Het
Irs1 TGGGGTGGACATCGAACTGAAGGAG TG 1: 82,287,732 probably null Het
Isl1 A G 13: 116,303,083 M243T probably benign Het
Itpr1 A T 6: 108,389,537 I142F probably damaging Het
Jak1 T C 4: 101,155,066 T1069A probably damaging Het
Jmjd1c T C 10: 67,233,446 V1848A probably benign Het
Kdm5a T C 6: 120,412,402 V930A probably damaging Het
Kdm5b C A 1: 134,593,315 probably null Het
Lexm T A 4: 106,610,527 probably null Het
Lilra5 T C 7: 4,238,714 F171L possibly damaging Het
Map1b A G 13: 99,431,054 S1720P unknown Het
Mcpt1 A T 14: 56,019,560 Q185L probably damaging Het
Mmp20 T A 9: 7,644,026 D238E possibly damaging Het
Mov10l1 A T 15: 89,020,269 I784F possibly damaging Het
Mroh2b C T 15: 4,904,270 P101S probably damaging Het
Myh3 G T 11: 67,096,939 A1413S probably benign Het
Nat6 A T 9: 107,583,539 Y211F probably damaging Het
Npdc1 G A 2: 25,408,945 D284N probably damaging Het
Olfr1009 A G 2: 85,721,449 I15V probably benign Het
Olfr1054 A T 2: 86,333,227 M43K probably benign Het
Olfr1056 G A 2: 86,355,750 L211F probably benign Het
Olfr1196 A G 2: 88,701,200 I43T probably damaging Het
Olfr330 A C 11: 58,529,482 M168R probably damaging Het
Olfr533 A G 7: 140,467,076 R292G probably damaging Het
Palld T A 8: 61,687,381 T531S probably benign Het
Parp4 A G 14: 56,585,738 E105G probably benign Het
Phf11a A T 14: 59,287,579 S59T probably damaging Het
Ppp1r12b G T 1: 134,955,733 A17E probably benign Het
Rad50 A T 11: 53,650,653 I1252N probably damaging Het
Ramp3 A G 11: 6,674,761 probably null Het
Rrbp1 G A 2: 143,988,417 T610I possibly damaging Het
Slc4a10 A G 2: 62,268,187 Y555C probably damaging Het
Slc5a2 A G 7: 128,267,505 probably null Het
Smoc1 T A 12: 81,179,548 D371E probably damaging Het
Stmn1 T A 4: 134,470,184 probably benign Het
Sulf1 C T 1: 12,842,686 L715F probably benign Het
Surf1 T C 2: 26,914,243 T180A possibly damaging Het
Syne2 A G 12: 75,979,819 I3474V probably damaging Het
Tchh A T 3: 93,445,148 R632W unknown Het
Tchh A T 3: 93,447,588 D1445V unknown Het
Tctn1 A T 5: 122,245,505 M505K probably benign Het
Tdrkh T A 3: 94,425,590 I150N probably damaging Het
Tespa1 C T 10: 130,362,159 T350I probably benign Het
Thbs1 A G 2: 118,115,018 Y326C possibly damaging Het
Tmem208 C T 8: 105,328,664 S119F probably damaging Het
Tmprss6 G C 15: 78,445,388 A91G probably damaging Het
Trp53bp2 C T 1: 182,431,582 R67W probably damaging Het
Ttn A G 2: 76,711,197 I25488T possibly damaging Het
Txnl4a A G 18: 80,222,253 E111G probably damaging Het
Unc13b T G 4: 43,237,137 I3402M probably damaging Het
Vmn1r188 A C 13: 22,088,121 I82L probably benign Het
Zfp65 A G 13: 67,708,875 V95A probably benign Het
Zfp985 T A 4: 147,584,155 S493R probably damaging Het
Other mutations in Ccnt1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00336:Ccnt1 APN 15 98565109 missense possibly damaging 0.75
IGL00900:Ccnt1 APN 15 98554633 missense probably damaging 1.00
IGL01798:Ccnt1 APN 15 98544241 missense probably benign 0.00
IGL02126:Ccnt1 APN 15 98567603 missense probably damaging 1.00
IGL02341:Ccnt1 APN 15 98546783 missense possibly damaging 0.92
R0049:Ccnt1 UTSW 15 98565079 missense probably benign 0.05
R0049:Ccnt1 UTSW 15 98565079 missense probably benign 0.05
R1116:Ccnt1 UTSW 15 98544338 missense probably damaging 1.00
R2063:Ccnt1 UTSW 15 98551942 missense probably benign 0.25
R2065:Ccnt1 UTSW 15 98551942 missense probably benign 0.25
R2066:Ccnt1 UTSW 15 98551942 missense probably benign 0.25
R2068:Ccnt1 UTSW 15 98551942 missense probably benign 0.25
R2180:Ccnt1 UTSW 15 98543600 missense possibly damaging 0.74
R3917:Ccnt1 UTSW 15 98544059 missense probably benign 0.00
R4805:Ccnt1 UTSW 15 98544308 missense probably benign 0.00
R4830:Ccnt1 UTSW 15 98543451 missense probably damaging 1.00
R5320:Ccnt1 UTSW 15 98544243 missense probably benign 0.35
R5740:Ccnt1 UTSW 15 98544500 missense probably benign 0.01
R5870:Ccnt1 UTSW 15 98543513 nonsense probably null
R6074:Ccnt1 UTSW 15 98543324 missense probably damaging 1.00
R6413:Ccnt1 UTSW 15 98543969 missense probably benign 0.01
R6610:Ccnt1 UTSW 15 98565101 missense probably damaging 1.00
R7260:Ccnt1 UTSW 15 98565124 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GGTTCTCCCAACTTAGACGC -3'
(R):5'- TGGAGGAAGTTCGTCACGTC -3'

Sequencing Primer
(F):5'- ACTTAGACGCCCAGCTCCTG -3'
(R):5'- AAGTTCGTCACGTCGCAGTAGTC -3'
Posted On2016-03-01