Incidental Mutation 'R4847:Cant1'
ID373325
Institutional Source Beutler Lab
Gene Symbol Cant1
Ensembl Gene ENSMUSG00000025575
Gene Namecalcium activated nucleotidase 1
Synonyms5830420C20Rik, D11Bwg0554e, SCAN-1, Apy1h, Shapy
MMRRC Submission 042460-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.116) question?
Stock #R4847 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location118406289-118419086 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 118410110 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 240 (Q240*)
Ref Sequence ENSEMBL: ENSMUSP00000101896 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000017620] [ENSMUST00000092378] [ENSMUST00000106287] [ENSMUST00000106288] [ENSMUST00000106289] [ENSMUST00000164927]
Predicted Effect probably benign
Transcript: ENSMUST00000017620
SMART Domains Protein: ENSMUSP00000017620
Gene: ENSMUSG00000025575

DomainStartEndE-ValueType
Pfam:Apyrase 115 403 7e-140 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000092378
SMART Domains Protein: ENSMUSP00000090032
Gene: ENSMUSG00000025575

DomainStartEndE-ValueType
Pfam:Apyrase 115 403 7e-140 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106287
SMART Domains Protein: ENSMUSP00000101894
Gene: ENSMUSG00000025575

DomainStartEndE-ValueType
Pfam:Apyrase 115 403 7e-140 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106288
SMART Domains Protein: ENSMUSP00000101895
Gene: ENSMUSG00000025575

DomainStartEndE-ValueType
Pfam:Apyrase 115 403 7e-140 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000106289
AA Change: Q240*
SMART Domains Protein: ENSMUSP00000101896
Gene: ENSMUSG00000025575
AA Change: Q240*

DomainStartEndE-ValueType
Pfam:Apyrase 115 216 6.3e-39 PFAM
Pfam:Apyrase 244 440 3.4e-92 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000164927
SMART Domains Protein: ENSMUSP00000126919
Gene: ENSMUSG00000025575

DomainStartEndE-ValueType
Pfam:Apyrase 115 403 7e-140 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.7%
Validation Efficiency
MGI Phenotype FUNCTION: The protein encoded by this gene is a calcium-dependent nucleotidase that preferentially hydrolyzes UDP, GDP, and IDP. The encoded protein has low activity with ADP and ATP and shows no activity with AMP and GMP. Several transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Jun 2012]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5730455P16Rik C T 11: 80,374,114 V171M probably damaging Het
Abhd3 A G 18: 10,647,786 S328P possibly damaging Het
Acot11 C T 4: 106,760,130 G240R probably damaging Het
Aldh1b1 G T 4: 45,802,625 K54N possibly damaging Het
Amacr C T 15: 10,994,872 Q257* probably null Het
Ankrd12 A T 17: 66,024,092 D309E probably benign Het
Anks6 T C 4: 47,033,266 T600A probably benign Het
Ap3b1 A G 13: 94,471,779 E586G probably benign Het
Atad2b A G 12: 4,944,901 probably null Het
Casc1 T A 6: 145,175,185 H636L probably damaging Het
Cep152 T C 2: 125,618,474 Y186C possibly damaging Het
Cep76 C A 18: 67,619,569 R603I probably benign Het
Chad T C 11: 94,568,327 S352P probably benign Het
Ckap2 T C 8: 22,175,068 E460G probably damaging Het
Col22a1 T C 15: 71,799,499 Y1004C unknown Het
Col9a3 G A 2: 180,615,525 G480S probably damaging Het
Cpsf2 A G 12: 101,997,302 D430G probably benign Het
Cramp1l T C 17: 24,985,089 D305G probably damaging Het
Ctnnd1 C A 2: 84,622,052 E76* probably null Het
Cybb C G X: 9,450,750 D246H probably benign Het
Cyp2c39 A T 19: 39,560,896 N286I probably damaging Het
Ddx11 A G 17: 66,130,801 E174G probably damaging Het
Ddx19a T C 8: 110,977,045 E369G probably damaging Het
Epha1 T A 6: 42,361,914 D687V possibly damaging Het
Fgr T C 4: 132,994,648 W132R probably damaging Het
Fras1 A T 5: 96,544,992 D170V possibly damaging Het
Gas2l1 A G 11: 5,064,173 S96P probably damaging Het
Gfy G A 7: 45,177,596 P359S probably damaging Het
Hexim2 A G 11: 103,138,941 N273S probably benign Het
Hr A T 14: 70,556,476 T59S probably benign Het
Impdh2 A G 9: 108,564,671 Y166C probably damaging Het
Impdh2 T A 9: 108,565,515 F514Y probably benign Het
Iqgap2 A G 13: 95,673,743 F731S probably benign Het
Klhl17 A T 4: 156,231,597 H433Q probably damaging Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Kntc1 A C 5: 123,802,274 N1645T probably benign Het
Mcm8 A G 2: 132,820,003 I114V probably benign Het
Mink1 T A 11: 70,602,028 L160Q probably damaging Het
Mipol1 A T 12: 57,303,496 S27C probably damaging Het
Mthfr T C 4: 148,048,139 V217A probably damaging Het
Olfr1458 A G 19: 13,102,534 Y257H probably damaging Het
Olfr473 T A 7: 107,933,827 C102* probably null Het
Pde1c T C 6: 56,123,034 K614E possibly damaging Het
Pds5b A T 5: 150,748,112 E407V probably damaging Het
Pdzph1 A G 17: 58,973,530 S586P possibly damaging Het
Prkcb C T 7: 122,568,149 R361W probably benign Het
Psen2 T A 1: 180,245,632 probably null Het
Ptk2 T A 15: 73,231,956 M82L probably benign Het
Ptk2b T C 14: 66,173,882 D400G probably damaging Het
Samd8 G A 14: 21,792,435 R275Q possibly damaging Het
Senp2 A G 16: 22,038,636 T403A possibly damaging Het
Serpinb13 C T 1: 106,982,844 S66L probably damaging Het
Skap2 T A 6: 52,003,669 I52L probably benign Het
Slc5a7 T C 17: 54,277,140 D374G possibly damaging Het
Slmap A T 14: 26,426,608 L699M possibly damaging Het
Sntg1 A C 1: 8,595,482 C203G possibly damaging Het
Stard9 T C 2: 120,703,113 S3284P probably benign Het
Tbx21 T C 11: 97,115,031 Y36C probably damaging Het
Tecpr2 A G 12: 110,939,877 Y971C probably damaging Het
Trpm5 T A 7: 143,087,763 I137F possibly damaging Het
Ttc30a2 A T 2: 75,977,714 N151K probably benign Het
Unk A G 11: 116,054,406 K426E probably damaging Het
Zc3hc1 T C 6: 30,375,982 D193G probably benign Het
Other mutations in Cant1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02927:Cant1 APN 11 118411062 missense probably benign 0.01
IGL02989:Cant1 APN 11 118411212 missense probably damaging 1.00
R0512:Cant1 UTSW 11 118411265 missense probably benign 0.26
R0535:Cant1 UTSW 11 118411143 missense probably damaging 1.00
R1953:Cant1 UTSW 11 118408783 missense probably damaging 1.00
R2154:Cant1 UTSW 11 118411437 missense probably damaging 1.00
R2187:Cant1 UTSW 11 118408841 nonsense probably null
R3916:Cant1 UTSW 11 118408746 missense probably damaging 0.98
R4065:Cant1 UTSW 11 118407997 missense probably benign
R4786:Cant1 UTSW 11 118408839 missense possibly damaging 0.68
R5093:Cant1 UTSW 11 118411212 missense probably damaging 1.00
R5265:Cant1 UTSW 11 118408050 missense probably damaging 1.00
R5281:Cant1 UTSW 11 118408870 missense probably damaging 0.99
R5506:Cant1 UTSW 11 118411442 missense probably benign 0.10
R5614:Cant1 UTSW 11 118408743 missense probably benign
R6705:Cant1 UTSW 11 118407872 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTTTTATCACCCAGGCAGG -3'
(R):5'- CCTTGTCATGTCTTCAGAGGTG -3'

Sequencing Primer
(F):5'- CAGGGCTGGGCAGACAGTAC -3'
(R):5'- CTTCAGAGGTGTCTTAGGATCACAC -3'
Posted On2016-03-01