Incidental Mutation 'R4849:Ralgapa1'
ID373418
Institutional Source Beutler Lab
Gene Symbol Ralgapa1
Ensembl Gene ENSMUSG00000021027
Gene NameRal GTPase activating protein, alpha subunit 1
SynonymsGarnl1, 4930400K19Rik, 2310003F20Rik, Tulip1
MMRRC Submission 042461-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.817) question?
Stock #R4849 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location55602896-55821167 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 55698803 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Tyrosine at position 1303 (N1303Y)
Ref Sequence ENSEMBL: ENSMUSP00000151857 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000085385] [ENSMUST00000110687] [ENSMUST00000219432] [ENSMUST00000220367] [ENSMUST00000226244]
Predicted Effect probably damaging
Transcript: ENSMUST00000085385
AA Change: N1256Y

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000082503
Gene: ENSMUSG00000021027
AA Change: N1256Y

DomainStartEndE-ValueType
low complexity region 644 651 N/A INTRINSIC
low complexity region 676 690 N/A INTRINSIC
low complexity region 692 704 N/A INTRINSIC
low complexity region 894 915 N/A INTRINSIC
low complexity region 1386 1395 N/A INTRINSIC
low complexity region 1784 1798 N/A INTRINSIC
Pfam:Rap_GAP 1824 2003 7.4e-66 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000110687
AA Change: N1256Y

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000106315
Gene: ENSMUSG00000021027
AA Change: N1256Y

DomainStartEndE-ValueType
low complexity region 644 651 N/A INTRINSIC
low complexity region 676 690 N/A INTRINSIC
low complexity region 692 704 N/A INTRINSIC
low complexity region 894 915 N/A INTRINSIC
low complexity region 1386 1395 N/A INTRINSIC
low complexity region 1784 1798 N/A INTRINSIC
Pfam:Rap_GAP 1824 2001 1.9e-48 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000219432
AA Change: N1303Y

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
Predicted Effect probably benign
Transcript: ENSMUST00000219566
Predicted Effect probably damaging
Transcript: ENSMUST00000220367
AA Change: N1256Y

PolyPhen 2 Score 0.972 (Sensitivity: 0.77; Specificity: 0.96)
Predicted Effect probably damaging
Transcript: ENSMUST00000226244
AA Change: N1712Y

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
Meta Mutation Damage Score 0.104 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.2%
Validation Efficiency 98% (90/92)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a major subunit of the RAL-GTPase activating protein. A similar protein in mouse binds E12, a transcriptional regulator of immunoglobulin genes. The mouse protein also functions in skeletal muscle by binding to the regulatory 14-3-3 proteins upon stimulation with insulin or muscle contraction. A pseudogene of this gene has been identified on chromosome 9. [provided by RefSeq, Oct 2016]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acp7 G T 7: 28,615,452 R239S possibly damaging Het
Angptl1 C A 1: 156,857,165 N301K probably benign Het
Ankrd26 T A 6: 118,532,296 T603S probably benign Het
App T C 16: 85,056,434 D252G unknown Het
Atxn3 A G 12: 101,934,368 S219P probably benign Het
Birc6 T C 17: 74,647,388 S3397P probably damaging Het
Bivm A G 1: 44,142,873 I414V possibly damaging Het
Cemip A G 7: 83,935,737 F1324L possibly damaging Het
Ckap5 T A 2: 91,615,271 N1724K probably damaging Het
Corin T A 5: 72,302,835 M1035L probably damaging Het
Ctnna3 T C 10: 64,873,315 I711T probably damaging Het
Cts6 A T 13: 61,201,601 W98R probably null Het
Dip2a A G 10: 76,294,533 S580P probably damaging Het
Dock6 A G 9: 21,811,772 probably null Het
Dusp15 T A 2: 152,949,082 T32S probably damaging Het
Eogt T A 6: 97,116,055 N387I probably damaging Het
Evx2 T C 2: 74,659,331 D29G probably benign Het
Fat1 A G 8: 45,012,970 N1422S probably benign Het
Fat2 T C 11: 55,310,637 D537G probably damaging Het
Fat3 A C 9: 16,377,948 I93S probably benign Het
Fem1b T C 9: 62,797,294 E228G probably damaging Het
Fh1 A G 1: 175,620,506 T25A probably benign Het
Fndc3b A G 3: 27,459,948 W695R probably damaging Het
Gaa G A 11: 119,272,987 V222I possibly damaging Het
Ggnbp1 T C 17: 27,032,973 probably null Het
Gipc1 A G 8: 83,662,127 Y154C probably benign Het
Gm5356 G T 8: 89,187,042 noncoding transcript Het
Gnl1 T A 17: 35,987,711 probably null Het
Gpcpd1 C T 2: 132,534,099 G605R probably damaging Het
Guca1a T C 17: 47,394,737 T177A possibly damaging Het
Ifit1bl1 T C 19: 34,594,676 E127G probably damaging Het
Ift81 A T 5: 122,591,219 I350N probably damaging Het
Ikbke GCC G 1: 131,275,267 probably null Het
Ing4 A G 6: 125,043,983 R23G probably damaging Het
Ins1 A G 19: 52,264,946 N108S probably damaging Het
Iqce A T 5: 140,693,459 M72K possibly damaging Het
Itga3 C A 11: 95,076,271 M22I probably benign Het
Kctd18 T C 1: 57,961,993 E201G probably damaging Het
Klc1 A G 12: 111,781,695 N344S probably damaging Het
Klrb1f A T 6: 129,056,384 I192F probably damaging Het
Klrg2 A T 6: 38,630,279 probably null Het
Kntc1 A C 5: 123,759,065 I164L probably benign Het
Ltf T A 9: 111,025,990 I357K probably benign Het
Mr1 T C 1: 155,130,690 T304A probably benign Het
Msh6 C T 17: 87,983,519 R178C possibly damaging Het
Mtch1 T C 17: 29,347,591 D66G probably benign Het
Mtmr7 A G 8: 40,608,997 V15A probably benign Het
Mtss1l A T 8: 110,726,243 H40L possibly damaging Het
Mxra8 A G 4: 155,840,874 probably benign Het
Myo3b T C 2: 70,244,909 L535P probably damaging Het
Neurl2 T A 2: 164,832,819 probably null Het
Nfia A C 4: 98,081,811 T503P probably damaging Het
Noa1 T C 5: 77,306,332 E487G possibly damaging Het
Nuak1 A T 10: 84,375,279 V315D probably damaging Het
Nup205 A G 6: 35,230,570 N1519S possibly damaging Het
Olfr107 T C 17: 37,405,698 V50A probably benign Het
Olfr364-ps1 T C 2: 37,146,254 L14P probably damaging Het
Olfr417 T A 1: 174,369,400 I161K probably damaging Het
Olfr466 G A 13: 65,152,679 V152M possibly damaging Het
Olfr524 G T 7: 140,202,427 C114* probably null Het
Olfr585 A G 7: 103,098,319 I193V possibly damaging Het
Peli1 T A 11: 21,148,528 probably benign Het
Ppp6r1 A G 7: 4,643,207 L175P probably damaging Het
Prkcd A G 14: 30,599,743 L498P probably damaging Het
Prss30 T A 17: 23,972,795 I251F probably benign Het
Psme3 A T 11: 101,317,081 N21Y probably benign Het
Ptpra T C 2: 130,532,161 Y271H probably damaging Het
Rims4 T C 2: 163,865,543 I121V probably benign Het
Rnf123 A T 9: 108,056,091 L1149Q probably damaging Het
Ryr3 T A 2: 112,908,462 L593F probably damaging Het
Sec23b T C 2: 144,585,599 F582S probably damaging Het
Sgpl1 T C 10: 61,104,518 K335R probably benign Het
Sirpa C T 2: 129,609,243 T141I probably damaging Het
Slit1 G T 19: 41,649,544 A270E probably benign Het
Snap91 T C 9: 86,792,560 T533A possibly damaging Het
Sphkap T G 1: 83,277,384 E881D probably benign Het
Sptan1 C A 2: 30,011,042 R1407S probably damaging Het
Tfdp1 A G 8: 13,373,895 T353A probably benign Het
Ttyh1 A G 7: 4,122,534 I62V possibly damaging Het
Vwde A T 6: 13,196,048 V326D possibly damaging Het
Zfp398 T C 6: 47,859,512 I82T possibly damaging Het
Zp1 A G 19: 10,918,834 Y176H possibly damaging Het
Other mutations in Ralgapa1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Ralgapa1 APN 12 55722773 missense probably damaging 0.98
IGL00494:Ralgapa1 APN 12 55747185 missense probably damaging 1.00
IGL00731:Ralgapa1 APN 12 55702452 missense possibly damaging 0.94
IGL00851:Ralgapa1 APN 12 55709575 missense possibly damaging 0.93
IGL01133:Ralgapa1 APN 12 55642348 missense probably damaging 1.00
IGL01133:Ralgapa1 APN 12 55642359 missense probably damaging 0.99
IGL01354:Ralgapa1 APN 12 55777316 missense possibly damaging 0.68
IGL01514:Ralgapa1 APN 12 55719657 missense probably damaging 0.97
IGL02033:Ralgapa1 APN 12 55642477 missense possibly damaging 0.69
IGL02064:Ralgapa1 APN 12 55708077 missense probably damaging 1.00
IGL02556:Ralgapa1 APN 12 55642449 missense possibly damaging 0.80
IGL02605:Ralgapa1 APN 12 55712665 missense possibly damaging 0.90
IGL02657:Ralgapa1 APN 12 55673507 missense probably damaging 1.00
IGL02676:Ralgapa1 APN 12 55676417 missense probably damaging 1.00
IGL02894:Ralgapa1 APN 12 55717069 missense possibly damaging 0.79
IGL02944:Ralgapa1 APN 12 55757951 missense probably benign 0.01
F5770:Ralgapa1 UTSW 12 55795653 splice site probably benign
IGL03046:Ralgapa1 UTSW 12 55695157 missense probably damaging 1.00
R0011:Ralgapa1 UTSW 12 55786263 missense probably damaging 0.99
R0096:Ralgapa1 UTSW 12 55739505 missense probably damaging 1.00
R0277:Ralgapa1 UTSW 12 55677238 missense probably damaging 0.99
R0323:Ralgapa1 UTSW 12 55677238 missense probably damaging 0.99
R0333:Ralgapa1 UTSW 12 55782900 splice site probably benign
R0361:Ralgapa1 UTSW 12 55676569 missense possibly damaging 0.93
R0385:Ralgapa1 UTSW 12 55677038 missense probably damaging 1.00
R0386:Ralgapa1 UTSW 12 55708067 missense probably benign 0.03
R0498:Ralgapa1 UTSW 12 55689791 missense possibly damaging 0.66
R0552:Ralgapa1 UTSW 12 55676765 missense probably benign 0.27
R0564:Ralgapa1 UTSW 12 55782885 missense possibly damaging 0.84
R0611:Ralgapa1 UTSW 12 55795698 missense probably damaging 0.99
R0730:Ralgapa1 UTSW 12 55665663 missense probably damaging 1.00
R0741:Ralgapa1 UTSW 12 55676581 missense probably damaging 0.99
R0815:Ralgapa1 UTSW 12 55762681 nonsense probably null
R0815:Ralgapa1 UTSW 12 55782777 splice site probably benign
R0863:Ralgapa1 UTSW 12 55762681 nonsense probably null
R0863:Ralgapa1 UTSW 12 55782777 splice site probably benign
R1068:Ralgapa1 UTSW 12 55790310 critical splice donor site probably null
R1147:Ralgapa1 UTSW 12 55702480 missense probably damaging 1.00
R1147:Ralgapa1 UTSW 12 55702480 missense probably damaging 1.00
R1256:Ralgapa1 UTSW 12 55762661 missense possibly damaging 0.94
R1343:Ralgapa1 UTSW 12 55707978 missense probably damaging 1.00
R1378:Ralgapa1 UTSW 12 55676926 missense probably damaging 1.00
R1474:Ralgapa1 UTSW 12 55741480 missense probably benign 0.09
R1494:Ralgapa1 UTSW 12 55684524 missense probably damaging 0.99
R1593:Ralgapa1 UTSW 12 55770703 missense probably damaging 1.00
R1607:Ralgapa1 UTSW 12 55741536 missense probably damaging 1.00
R1681:Ralgapa1 UTSW 12 55762603 missense probably benign 0.35
R1689:Ralgapa1 UTSW 12 55676767 missense possibly damaging 0.79
R1714:Ralgapa1 UTSW 12 55642389 missense probably damaging 1.00
R1832:Ralgapa1 UTSW 12 55757967 missense probably benign 0.03
R1870:Ralgapa1 UTSW 12 55677032 missense possibly damaging 0.66
R2040:Ralgapa1 UTSW 12 55786322 missense probably damaging 1.00
R2043:Ralgapa1 UTSW 12 55677026 missense probably damaging 0.99
R2046:Ralgapa1 UTSW 12 55695160 missense probably damaging 1.00
R2109:Ralgapa1 UTSW 12 55776188 missense possibly damaging 0.90
R2114:Ralgapa1 UTSW 12 55786349 critical splice acceptor site probably null
R2115:Ralgapa1 UTSW 12 55786349 critical splice acceptor site probably null
R2202:Ralgapa1 UTSW 12 55612800 intron probably null
R2203:Ralgapa1 UTSW 12 55612800 intron probably null
R2233:Ralgapa1 UTSW 12 55717071 missense probably benign 0.13
R2235:Ralgapa1 UTSW 12 55717071 missense probably benign 0.13
R2341:Ralgapa1 UTSW 12 55677124 missense possibly damaging 0.66
R2507:Ralgapa1 UTSW 12 55718201 missense probably damaging 1.00
R2508:Ralgapa1 UTSW 12 55718201 missense probably damaging 1.00
R2972:Ralgapa1 UTSW 12 55820755 missense possibly damaging 0.61
R3160:Ralgapa1 UTSW 12 55709586 missense probably damaging 1.00
R3162:Ralgapa1 UTSW 12 55709586 missense probably damaging 1.00
R3401:Ralgapa1 UTSW 12 55659137 missense possibly damaging 0.66
R3416:Ralgapa1 UTSW 12 55770613 splice site probably benign
R3499:Ralgapa1 UTSW 12 55695143 splice site probably benign
R3799:Ralgapa1 UTSW 12 55659130 missense probably damaging 1.00
R3948:Ralgapa1 UTSW 12 55698767 missense probably damaging 1.00
R4039:Ralgapa1 UTSW 12 55795701 missense probably damaging 0.99
R4120:Ralgapa1 UTSW 12 55640644 missense probably damaging 1.00
R4165:Ralgapa1 UTSW 12 55640644 missense probably damaging 1.00
R4166:Ralgapa1 UTSW 12 55640644 missense probably damaging 1.00
R4212:Ralgapa1 UTSW 12 55739330 critical splice donor site probably null
R4232:Ralgapa1 UTSW 12 55640644 missense probably damaging 1.00
R4233:Ralgapa1 UTSW 12 55640644 missense probably damaging 1.00
R4234:Ralgapa1 UTSW 12 55640644 missense probably damaging 1.00
R4235:Ralgapa1 UTSW 12 55640644 missense probably damaging 1.00
R4399:Ralgapa1 UTSW 12 55795778 critical splice acceptor site probably null
R4698:Ralgapa1 UTSW 12 55677276 splice site probably null
R4715:Ralgapa1 UTSW 12 55693458 missense probably damaging 1.00
R4755:Ralgapa1 UTSW 12 55712748 missense probably damaging 1.00
R4810:Ralgapa1 UTSW 12 55794993 critical splice donor site probably null
R4827:Ralgapa1 UTSW 12 55676437 missense probably damaging 1.00
R4934:Ralgapa1 UTSW 12 55762574 missense possibly damaging 0.94
R5006:Ralgapa1 UTSW 12 55718114 missense probably benign 0.02
R5114:Ralgapa1 UTSW 12 55612723 missense possibly damaging 0.84
R5140:Ralgapa1 UTSW 12 55776152 missense probably damaging 1.00
R5140:Ralgapa1 UTSW 12 55665674 missense probably damaging 1.00
R5168:Ralgapa1 UTSW 12 55758032 missense probably benign 0.05
R5407:Ralgapa1 UTSW 12 55676797 missense possibly damaging 0.93
R5441:Ralgapa1 UTSW 12 55719623 missense probably damaging 1.00
R5473:Ralgapa1 UTSW 12 55676710 missense probably benign 0.41
R5624:Ralgapa1 UTSW 12 55612738 missense probably damaging 1.00
R5766:Ralgapa1 UTSW 12 55820766 start codon destroyed probably null 0.99
R5826:Ralgapa1 UTSW 12 55677113 missense probably damaging 1.00
R5950:Ralgapa1 UTSW 12 55738265 missense possibly damaging 0.58
R5980:Ralgapa1 UTSW 12 55770616 splice site probably null
R6019:Ralgapa1 UTSW 12 55684042 missense possibly damaging 0.92
R6065:Ralgapa1 UTSW 12 55757924 critical splice donor site probably null
R6326:Ralgapa1 UTSW 12 55747146 missense probably damaging 1.00
R6355:Ralgapa1 UTSW 12 55698854 missense probably damaging 1.00
R6408:Ralgapa1 UTSW 12 55683910 nonsense probably null
R6448:Ralgapa1 UTSW 12 55719661 missense probably benign 0.14
R6453:Ralgapa1 UTSW 12 55738319 missense probably damaging 1.00
R6593:Ralgapa1 UTSW 12 55722773 critical splice donor site probably null
R6690:Ralgapa1 UTSW 12 55722773 critical splice donor site probably null
R6738:Ralgapa1 UTSW 12 55762727 missense probably damaging 1.00
R6836:Ralgapa1 UTSW 12 55604273 splice site probably null
R6936:Ralgapa1 UTSW 12 55786212 missense probably damaging 0.99
R6945:Ralgapa1 UTSW 12 55776191 missense possibly damaging 0.64
Predicted Primers PCR Primer
(F):5'- CCTGAAAAGGCTTTGCTCATAG -3'
(R):5'- AACTGTGGCATGCTCCTTC -3'

Sequencing Primer
(F):5'- GGCTTTGCTCATAGTAGACATTC -3'
(R):5'- GAGTCTTTTCATGAACTCACTGC -3'
Posted On2016-03-01