Incidental Mutation 'R4851:Dock10'
ID373510
Institutional Source Beutler Lab
Gene Symbol Dock10
Ensembl Gene ENSMUSG00000038608
Gene Namededicator of cytokinesis 10
SynonymsJr5, Zizimin3, A630054M16Rik, Jr4, 9330153B10Rik, ZIZ3
MMRRC Submission 042463-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.333) question?
Stock #R4851 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location80501073-80758527 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 80549157 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 782 (S782T)
Ref Sequence ENSEMBL: ENSMUSP00000139567 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077946] [ENSMUST00000187774] [ENSMUST00000190595] [ENSMUST00000190983]
Predicted Effect probably benign
Transcript: ENSMUST00000077946
AA Change: S1129T

PolyPhen 2 Score 0.320 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000077099
Gene: ENSMUSG00000038608
AA Change: S1129T

DomainStartEndE-ValueType
low complexity region 25 42 N/A INTRINSIC
Pfam:DUF3398 61 153 1.7e-36 PFAM
PH 182 292 8.5e-17 SMART
Blast:PH 350 458 7e-18 BLAST
Pfam:DOCK-C2 668 859 1e-50 PFAM
low complexity region 1269 1279 N/A INTRINSIC
low complexity region 1284 1295 N/A INTRINSIC
Pfam:DHR-2 1592 2143 1.3e-216 PFAM
low complexity region 2174 2187 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000187774
AA Change: S1117T

PolyPhen 2 Score 0.209 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000140085
Gene: ENSMUSG00000038608
AA Change: S1117T

DomainStartEndE-ValueType
Pfam:DUF3398 46 141 9e-29 PFAM
PH 170 280 3.9e-19 SMART
Blast:PH 338 446 7e-18 BLAST
Pfam:DOCK-C2 655 848 1.5e-54 PFAM
low complexity region 1257 1267 N/A INTRINSIC
low complexity region 1272 1283 N/A INTRINSIC
low complexity region 1870 1890 N/A INTRINSIC
Pfam:Ded_cyto 1954 2131 3.4e-65 PFAM
low complexity region 2162 2175 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000190595
AA Change: S782T

PolyPhen 2 Score 0.326 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000139567
Gene: ENSMUSG00000038608
AA Change: S782T

DomainStartEndE-ValueType
Blast:PH 3 111 5e-18 BLAST
Pfam:DOCK-C2 320 513 1.2e-54 PFAM
low complexity region 922 932 N/A INTRINSIC
low complexity region 937 948 N/A INTRINSIC
low complexity region 1508 1522 N/A INTRINSIC
Pfam:Ded_cyto 1588 1765 2.7e-65 PFAM
low complexity region 1783 1795 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000190983
AA Change: S1116T

PolyPhen 2 Score 0.209 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000140719
Gene: ENSMUSG00000038608
AA Change: S1116T

DomainStartEndE-ValueType
Pfam:DUF3398 45 140 8.9e-29 PFAM
PH 169 279 3.9e-19 SMART
Blast:PH 337 445 7e-18 BLAST
Pfam:DOCK-C2 654 847 1.5e-54 PFAM
low complexity region 1256 1266 N/A INTRINSIC
low complexity region 1271 1282 N/A INTRINSIC
low complexity region 1869 1889 N/A INTRINSIC
Pfam:Ded_cyto 1953 2130 3.4e-65 PFAM
Meta Mutation Damage Score 0.07 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.0%
Validation Efficiency 100% (99/99)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the dedicator of cytokinesis protein family. Members of this family are guanosine nucleotide exchange factors for Rho GTPases and defined by the presence of conserved DOCK-homology regions. The encoded protein belongs to the D (or Zizimin) subfamily of DOCK proteins, which also contain an N-terminal pleckstrin homology domain. Alternatively spliced transcript variants that encode different isoforms have been described. [provided by RefSeq, Mar 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit a reduction of B cell numbers in secondary lymphoid organs. Follicular B cells show membrane CD23 overexpression. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930451G09Rik A G 16: 4,976,274 noncoding transcript Het
Abca13 A T 11: 9,483,890 R4148S probably benign Het
Acoxl T A 2: 128,044,391 L182Q possibly damaging Het
Aldh7a1 T C 18: 56,532,016 T364A possibly damaging Het
App T C 16: 85,056,434 D252G unknown Het
Arid1a A G 4: 133,681,361 I1945T unknown Het
Arsk C T 13: 76,065,279 probably null Het
Atad2b G A 12: 4,943,251 G257S probably benign Het
Best1 C A 19: 9,991,698 R218L probably damaging Het
Cacna1e A T 1: 154,436,554 probably null Het
Cdh13 C T 8: 118,757,390 T130I possibly damaging Het
Cela2a T C 4: 141,825,591 E25G probably benign Het
Cgnl1 T A 9: 71,725,032 I346F probably damaging Het
Chil6 C T 3: 106,389,928 G299D possibly damaging Het
Cic G A 7: 25,272,902 R686H probably damaging Het
Cnpy1 T C 5: 28,245,740 I23V probably benign Het
Col6a3 T A 1: 90,779,289 Y2034F unknown Het
Coq10b T C 1: 55,071,744 Y224H probably benign Het
Cryge G T 1: 65,051,052 probably benign Het
Cyb5rl T G 4: 107,084,313 S252A probably benign Het
Cyp2ab1 T A 16: 20,315,064 R125S probably damaging Het
Dclk1 G A 3: 55,480,390 G86R probably damaging Het
Dmtn A G 14: 70,604,814 M382T probably damaging Het
Dnah12 T A 14: 26,716,629 L471* probably null Het
Egfem1 C A 3: 29,151,883 H90N possibly damaging Het
Ephb6 T A 6: 41,618,145 W698R probably benign Het
Exoc4 T A 6: 33,918,408 C787S probably damaging Het
Exosc8 A T 3: 54,732,102 probably benign Het
Galc T A 12: 98,227,274 Q352L probably benign Het
Galns A G 8: 122,600,533 Y167H probably damaging Het
Glb1l T C 1: 75,208,884 probably benign Het
Gm6185 A T 1: 161,206,180 noncoding transcript Het
Gm7694 T C 1: 170,301,225 N245S probably benign Het
Gmcl1 T G 6: 86,704,556 K385N possibly damaging Het
Gramd1c A T 16: 43,989,837 W463R probably damaging Het
Gtpbp8 C G 16: 44,746,070 A90P probably benign Het
Hcar1 T C 5: 123,878,668 E320G probably benign Het
Hhatl T C 9: 121,789,011 D226G probably damaging Het
Hist1h2bj G T 13: 22,043,251 probably benign Het
Hoxc5 T A 15: 103,015,369 I199N probably damaging Het
Iars2 T C 1: 185,327,648 D121G probably damaging Het
Il5ra T A 6: 106,738,471 H134L probably benign Het
Isl2 T A 9: 55,544,987 I281N possibly damaging Het
Kcnk13 T C 12: 99,966,124 F60L probably damaging Het
Kdelr3 C T 15: 79,524,865 T85M possibly damaging Het
Kdf1 A T 4: 133,528,365 H131L probably damaging Het
Mipol1 T A 12: 57,332,301 L182I probably damaging Het
Morc1 T G 16: 48,561,617 S513R probably benign Het
Moxd2 A T 6: 40,878,822 L611H probably damaging Het
Mpped2 T C 2: 106,699,379 probably benign Het
Mrpl51 T C 6: 125,193,307 V92A probably benign Het
Mrps26 G A 2: 130,563,761 probably benign Het
Mrps5 A G 2: 127,590,745 T29A probably benign Het
Mustn1 A G 14: 30,879,560 probably benign Het
Ncor2 G A 5: 125,033,367 P858S possibly damaging Het
Nfasc A G 1: 132,602,021 F807S probably damaging Het
Nup50 G A 15: 84,939,711 V422I probably benign Het
Olfr1044 T A 2: 86,171,671 I49F probably damaging Het
Olfr1212 A G 2: 88,958,586 N40S probably damaging Het
Olfr384 A T 11: 73,603,057 H159L probably damaging Het
Olfr411 C A 11: 74,346,943 V214L probably benign Het
Olfr417 T A 1: 174,368,996 F26L probably benign Het
Olfr539 A T 7: 140,667,313 M2L probably benign Het
Olfr695 A T 7: 106,874,014 V77D probably damaging Het
Olfr907 T A 9: 38,499,023 M118K probably damaging Het
Osbpl8 T A 10: 111,204,800 M1K probably null Het
Pcdhb22 A C 18: 37,519,034 D185A possibly damaging Het
Pcdhga8 G T 18: 37,816,404 R291L probably damaging Het
Saysd1 A T 14: 20,077,604 L84Q possibly damaging Het
Slc41a1 T C 1: 131,830,770 I50T probably benign Het
Smg7 G A 1: 152,844,269 P834S probably benign Het
Speer4a C T 5: 26,038,212 V92M probably damaging Het
Srf T C 17: 46,549,474 T461A probably benign Het
Ssu72 A G 4: 155,715,596 D72G possibly damaging Het
Suco T C 1: 161,834,192 E890G probably damaging Het
Tenm3 A G 8: 48,310,621 probably null Het
Tm6sf1 A G 7: 81,865,343 E7G probably null Het
Tm9sf2 A G 14: 122,141,204 K240R probably benign Het
Tmem52 T A 4: 155,470,368 Y149* probably null Het
Tpgs2 A T 18: 25,151,248 Y68N possibly damaging Het
Vmn1r205 T A 13: 22,592,904 E9D probably benign Het
Vmn2r32 A G 7: 7,479,954 V7A possibly damaging Het
Vmn2r80 T C 10: 79,194,322 Y661H possibly damaging Het
Vps39 G A 2: 120,321,831 probably benign Het
Vwde A T 6: 13,196,048 V326D possibly damaging Het
Zfp641 T A 15: 98,288,717 S342C probably damaging Het
Zfp961 T C 8: 71,969,003 probably benign Het
Other mutations in Dock10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00569:Dock10 APN 1 80585012 missense probably damaging 1.00
IGL00783:Dock10 APN 1 80572449 splice site probably benign
IGL00784:Dock10 APN 1 80572449 splice site probably benign
IGL00858:Dock10 APN 1 80568003 missense possibly damaging 0.48
IGL01298:Dock10 APN 1 80531245 missense probably damaging 1.00
IGL01351:Dock10 APN 1 80593159 missense probably damaging 1.00
IGL01356:Dock10 APN 1 80523742 missense probably damaging 1.00
IGL01584:Dock10 APN 1 80533850 missense probably damaging 0.99
IGL01619:Dock10 APN 1 80634298 splice site probably benign
IGL01678:Dock10 APN 1 80543352 missense probably damaging 1.00
IGL01759:Dock10 APN 1 80526273 missense probably damaging 1.00
IGL02238:Dock10 APN 1 80533793 missense probably damaging 0.99
IGL02352:Dock10 APN 1 80505661 missense probably damaging 1.00
IGL02359:Dock10 APN 1 80505661 missense probably damaging 1.00
IGL02377:Dock10 APN 1 80584994 critical splice donor site probably null
IGL02433:Dock10 APN 1 80530188 missense probably damaging 1.00
IGL02471:Dock10 APN 1 80515622 missense probably damaging 0.99
IGL02645:Dock10 APN 1 80574123 missense probably damaging 1.00
IGL02646:Dock10 APN 1 80574123 missense probably damaging 1.00
IGL02648:Dock10 APN 1 80574123 missense probably damaging 1.00
IGL02649:Dock10 APN 1 80574123 missense probably damaging 1.00
IGL02650:Dock10 APN 1 80574123 missense probably damaging 1.00
IGL02652:Dock10 APN 1 80592844 unclassified probably null
IGL02718:Dock10 APN 1 80523818 missense probably benign 0.00
IGL02998:Dock10 APN 1 80573542 missense probably damaging 1.00
IGL03057:Dock10 APN 1 80567371 missense probably damaging 1.00
IGL03066:Dock10 APN 1 80585041 missense probably benign 0.00
IGL03106:Dock10 APN 1 80568834 missense probably damaging 0.98
IGL03148:Dock10 APN 1 80540358 missense probably benign 0.01
IGL03271:Dock10 APN 1 80505409 missense probably damaging 1.00
IGL03352:Dock10 APN 1 80606296 splice site probably benign
LCD18:Dock10 UTSW 1 80716623 intron probably benign
PIT4366001:Dock10 UTSW 1 80595721 missense probably benign 0.30
PIT4581001:Dock10 UTSW 1 80505446 missense probably damaging 1.00
R0019:Dock10 UTSW 1 80605925 missense probably damaging 1.00
R0081:Dock10 UTSW 1 80606578 missense probably damaging 0.99
R0095:Dock10 UTSW 1 80524071 missense probably benign 0.00
R0241:Dock10 UTSW 1 80578623 missense probably benign
R0241:Dock10 UTSW 1 80578623 missense probably benign
R0255:Dock10 UTSW 1 80605876 missense probably damaging 1.00
R0267:Dock10 UTSW 1 80512454 missense probably damaging 1.00
R0299:Dock10 UTSW 1 80536929 missense probably damaging 0.99
R0365:Dock10 UTSW 1 80595683 missense probably damaging 1.00
R0387:Dock10 UTSW 1 80540276 missense probably damaging 1.00
R0403:Dock10 UTSW 1 80524070 missense possibly damaging 0.94
R0408:Dock10 UTSW 1 80540476 missense probably benign 0.03
R0414:Dock10 UTSW 1 80535933 missense possibly damaging 0.93
R0591:Dock10 UTSW 1 80541219 splice site probably benign
R0698:Dock10 UTSW 1 80530178 missense probably damaging 1.00
R0711:Dock10 UTSW 1 80523975 missense probably damaging 1.00
R0925:Dock10 UTSW 1 80536940 missense probably benign 0.20
R1162:Dock10 UTSW 1 80568842 missense possibly damaging 0.58
R1370:Dock10 UTSW 1 80540343 missense probably damaging 1.00
R1440:Dock10 UTSW 1 80549136 missense probably benign 0.03
R1469:Dock10 UTSW 1 80512558 missense probably benign 0.05
R1469:Dock10 UTSW 1 80512558 missense probably benign 0.05
R1525:Dock10 UTSW 1 80606164 critical splice donor site probably null
R1544:Dock10 UTSW 1 80592635 missense probably benign 0.00
R1601:Dock10 UTSW 1 80549802 missense probably benign 0.00
R1757:Dock10 UTSW 1 80533869 missense probably damaging 1.00
R1765:Dock10 UTSW 1 80605823 missense probably damaging 1.00
R1783:Dock10 UTSW 1 80574180 missense probably benign 0.17
R1823:Dock10 UTSW 1 80543097 splice site probably null
R1827:Dock10 UTSW 1 80530292 missense probably benign 0.07
R1844:Dock10 UTSW 1 80543201 missense probably damaging 0.99
R1856:Dock10 UTSW 1 80606568 missense possibly damaging 0.46
R1974:Dock10 UTSW 1 80510426 missense possibly damaging 0.50
R2006:Dock10 UTSW 1 80549789 missense possibly damaging 0.95
R2112:Dock10 UTSW 1 80505642 missense probably damaging 1.00
R2112:Dock10 UTSW 1 80505643 missense probably damaging 0.99
R2113:Dock10 UTSW 1 80606563 missense probably damaging 1.00
R2439:Dock10 UTSW 1 80532432 missense probably damaging 1.00
R2566:Dock10 UTSW 1 80540253 missense possibly damaging 0.88
R3086:Dock10 UTSW 1 80532357 missense possibly damaging 0.91
R3766:Dock10 UTSW 1 80536926 missense probably damaging 0.99
R3768:Dock10 UTSW 1 80532368 missense probably damaging 1.00
R4009:Dock10 UTSW 1 80532431 missense probably damaging 1.00
R4016:Dock10 UTSW 1 80606569 missense probably damaging 1.00
R4179:Dock10 UTSW 1 80510417 missense probably benign 0.00
R4243:Dock10 UTSW 1 80566755 missense probably benign 0.00
R4244:Dock10 UTSW 1 80566755 missense probably benign 0.00
R4245:Dock10 UTSW 1 80566755 missense probably benign 0.00
R4674:Dock10 UTSW 1 80606620 missense possibly damaging 0.79
R4696:Dock10 UTSW 1 80515613 missense possibly damaging 0.95
R4789:Dock10 UTSW 1 80541281 missense probably damaging 1.00
R4911:Dock10 UTSW 1 80606236 missense probably damaging 1.00
R4976:Dock10 UTSW 1 80567994 critical splice donor site probably null
R5086:Dock10 UTSW 1 80551472 missense possibly damaging 0.89
R5119:Dock10 UTSW 1 80567994 critical splice donor site probably null
R5301:Dock10 UTSW 1 80648256 missense probably benign 0.41
R5404:Dock10 UTSW 1 80503913 intron probably benign
R5457:Dock10 UTSW 1 80524064 missense probably damaging 1.00
R5790:Dock10 UTSW 1 80505170 missense probably benign 0.00
R5845:Dock10 UTSW 1 80505742 intron probably benign
R5871:Dock10 UTSW 1 80541340 critical splice acceptor site probably null
R5873:Dock10 UTSW 1 80574138 missense probably damaging 1.00
R5881:Dock10 UTSW 1 80560923 missense probably benign 0.19
R5895:Dock10 UTSW 1 80536959 missense probably benign
R5935:Dock10 UTSW 1 80505587 intron probably benign
R5965:Dock10 UTSW 1 80568744 splice site probably null
R5966:Dock10 UTSW 1 80568508 missense possibly damaging 0.84
R6008:Dock10 UTSW 1 80606173 missense probably damaging 0.98
R6029:Dock10 UTSW 1 80536946 missense possibly damaging 0.68
R6083:Dock10 UTSW 1 80532431 missense probably damaging 1.00
R6145:Dock10 UTSW 1 80575904 nonsense probably null
R6257:Dock10 UTSW 1 80503696 intron probably benign
R6274:Dock10 UTSW 1 80538823 missense probably damaging 1.00
R6324:Dock10 UTSW 1 80505176 missense probably benign 0.03
R6346:Dock10 UTSW 1 80575856 splice site probably null
R6476:Dock10 UTSW 1 80541242 nonsense probably null
R6516:Dock10 UTSW 1 80540461 missense probably damaging 1.00
R6526:Dock10 UTSW 1 80586351 missense probably damaging 0.97
R6534:Dock10 UTSW 1 80503671 missense probably benign 0.01
R6620:Dock10 UTSW 1 80592638 missense probably benign 0.01
R6640:Dock10 UTSW 1 80533838 nonsense probably null
R6669:Dock10 UTSW 1 80592855 missense probably damaging 1.00
R6672:Dock10 UTSW 1 80512531 missense probably benign 0.00
R6679:Dock10 UTSW 1 80566797 missense probably benign 0.11
R6682:Dock10 UTSW 1 80512621 missense probably damaging 1.00
R6712:Dock10 UTSW 1 80536866 missense probably benign 0.00
R6726:Dock10 UTSW 1 80512430 missense probably damaging 1.00
R6788:Dock10 UTSW 1 80531245 missense probably damaging 1.00
R6805:Dock10 UTSW 1 80586690 missense probably benign
R6815:Dock10 UTSW 1 80538859 missense possibly damaging 0.94
R6818:Dock10 UTSW 1 80615365 missense possibly damaging 0.95
R6867:Dock10 UTSW 1 80531259 missense probably damaging 1.00
R6964:Dock10 UTSW 1 80503648 intron probably benign
R7026:Dock10 UTSW 1 80501787 missense probably benign 0.40
R7084:Dock10 UTSW 1 80503856 missense
R7087:Dock10 UTSW 1 80592826 missense probably benign
R7158:Dock10 UTSW 1 80586872 critical splice acceptor site probably null
R7191:Dock10 UTSW 1 80540331 missense possibly damaging 0.93
R7214:Dock10 UTSW 1 80568529 missense probably benign 0.01
R7255:Dock10 UTSW 1 80543099 critical splice donor site probably null
R7320:Dock10 UTSW 1 80549704 critical splice donor site probably null
X0025:Dock10 UTSW 1 80536920 missense probably damaging 0.98
X0065:Dock10 UTSW 1 80541260 missense probably damaging 1.00
Z1088:Dock10 UTSW 1 80532347 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGAAAATTAAGATGGCAACCC -3'
(R):5'- GGAGCATACAAACTAAGTTTTCTTGGG -3'

Sequencing Primer
(F):5'- TTAAGATGGCAACCCCTGAAG -3'
(R):5'- TCTTGGGAAATGATGATGTAA -3'
Posted On2016-03-01