Incidental Mutation 'R4851:4930451G09Rik'
List |< first << previous [record 69 of 1920] next >> last >|
ID373582
Institutional Source Beutler Lab
Gene Symbol 4930451G09Rik
Ensembl Gene ENSMUSG00000022543
Gene NameRIKEN cDNA 4930451G09 gene
Synonyms
MMRRC Submission 042463-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.080) question?
Stock #R4851 (G1)
Quality Score210
Status Validated
Chromosome16
Chromosomal Location4968936-4978962 bp(+) (GRCm38)
Type of Mutationexon
DNA Base Change (assembly) A to G at 4976274 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000090457]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000090457
SMART Domains Protein: ENSMUSP00000087942
Gene: ENSMUSG00000022543

DomainStartEndE-ValueType
Pfam:DUF4701 1 195 7.5e-72 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229669
Meta Mutation Damage Score 0.332 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.0%
Validation Efficiency 100% (99/99)
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 A T 11: 9,483,890 R4148S probably benign Het
Acoxl T A 2: 128,044,391 L182Q possibly damaging Het
Aldh7a1 T C 18: 56,532,016 T364A possibly damaging Het
App T C 16: 85,056,434 D252G unknown Het
Arid1a A G 4: 133,681,361 I1945T unknown Het
Arsk C T 13: 76,065,279 probably null Het
Atad2b G A 12: 4,943,251 G257S probably benign Het
Best1 C A 19: 9,991,698 R218L probably damaging Het
Cacna1e A T 1: 154,436,554 probably null Het
Cdh13 C T 8: 118,757,390 T130I possibly damaging Het
Cela2a T C 4: 141,825,591 E25G probably benign Het
Cgnl1 T A 9: 71,725,032 I346F probably damaging Het
Chil6 C T 3: 106,389,928 G299D possibly damaging Het
Cic G A 7: 25,272,902 R686H probably damaging Het
Cnpy1 T C 5: 28,245,740 I23V probably benign Het
Col6a3 T A 1: 90,779,289 Y2034F unknown Het
Coq10b T C 1: 55,071,744 Y224H probably benign Het
Cryge G T 1: 65,051,052 probably benign Het
Cyb5rl T G 4: 107,084,313 S252A probably benign Het
Cyp2ab1 T A 16: 20,315,064 R125S probably damaging Het
Dclk1 G A 3: 55,480,390 G86R probably damaging Het
Dmtn A G 14: 70,604,814 M382T probably damaging Het
Dnah12 T A 14: 26,716,629 L471* probably null Het
Dock10 A T 1: 80,549,157 S782T probably benign Het
Egfem1 C A 3: 29,151,883 H90N possibly damaging Het
Ephb6 T A 6: 41,618,145 W698R probably benign Het
Exoc4 T A 6: 33,918,408 C787S probably damaging Het
Exosc8 A T 3: 54,732,102 probably benign Het
Galc T A 12: 98,227,274 Q352L probably benign Het
Galns A G 8: 122,600,533 Y167H probably damaging Het
Glb1l T C 1: 75,208,884 probably benign Het
Gm6185 A T 1: 161,206,180 noncoding transcript Het
Gm7694 T C 1: 170,301,225 N245S probably benign Het
Gmcl1 T G 6: 86,704,556 K385N possibly damaging Het
Gramd1c A T 16: 43,989,837 W463R probably damaging Het
Gtpbp8 C G 16: 44,746,070 A90P probably benign Het
Hcar1 T C 5: 123,878,668 E320G probably benign Het
Hhatl T C 9: 121,789,011 D226G probably damaging Het
Hist1h2bj G T 13: 22,043,251 probably benign Het
Hoxc5 T A 15: 103,015,369 I199N probably damaging Het
Iars2 T C 1: 185,327,648 D121G probably damaging Het
Il5ra T A 6: 106,738,471 H134L probably benign Het
Isl2 T A 9: 55,544,987 I281N possibly damaging Het
Kcnk13 T C 12: 99,966,124 F60L probably damaging Het
Kdelr3 C T 15: 79,524,865 T85M possibly damaging Het
Kdf1 A T 4: 133,528,365 H131L probably damaging Het
Mipol1 T A 12: 57,332,301 L182I probably damaging Het
Morc1 T G 16: 48,561,617 S513R probably benign Het
Moxd2 A T 6: 40,878,822 L611H probably damaging Het
Mpped2 T C 2: 106,699,379 probably benign Het
Mrpl51 T C 6: 125,193,307 V92A probably benign Het
Mrps26 G A 2: 130,563,761 probably benign Het
Mrps5 A G 2: 127,590,745 T29A probably benign Het
Mustn1 A G 14: 30,879,560 probably benign Het
Ncor2 G A 5: 125,033,367 P858S possibly damaging Het
Nfasc A G 1: 132,602,021 F807S probably damaging Het
Nup50 G A 15: 84,939,711 V422I probably benign Het
Olfr1044 T A 2: 86,171,671 I49F probably damaging Het
Olfr1212 A G 2: 88,958,586 N40S probably damaging Het
Olfr384 A T 11: 73,603,057 H159L probably damaging Het
Olfr411 C A 11: 74,346,943 V214L probably benign Het
Olfr417 T A 1: 174,368,996 F26L probably benign Het
Olfr539 A T 7: 140,667,313 M2L probably benign Het
Olfr695 A T 7: 106,874,014 V77D probably damaging Het
Olfr907 T A 9: 38,499,023 M118K probably damaging Het
Osbpl8 T A 10: 111,204,800 M1K probably null Het
Pcdhb22 A C 18: 37,519,034 D185A possibly damaging Het
Pcdhga8 G T 18: 37,816,404 R291L probably damaging Het
Saysd1 A T 14: 20,077,604 L84Q possibly damaging Het
Slc41a1 T C 1: 131,830,770 I50T probably benign Het
Smg7 G A 1: 152,844,269 P834S probably benign Het
Speer4a C T 5: 26,038,212 V92M probably damaging Het
Srf T C 17: 46,549,474 T461A probably benign Het
Ssu72 A G 4: 155,715,596 D72G possibly damaging Het
Suco T C 1: 161,834,192 E890G probably damaging Het
Tenm3 A G 8: 48,310,621 probably null Het
Tm6sf1 A G 7: 81,865,343 E7G probably null Het
Tm9sf2 A G 14: 122,141,204 K240R probably benign Het
Tmem52 T A 4: 155,470,368 Y149* probably null Het
Tpgs2 A T 18: 25,151,248 Y68N possibly damaging Het
Vmn1r205 T A 13: 22,592,904 E9D probably benign Het
Vmn2r32 A G 7: 7,479,954 V7A possibly damaging Het
Vmn2r80 T C 10: 79,194,322 Y661H possibly damaging Het
Vps39 G A 2: 120,321,831 probably benign Het
Vwde A T 6: 13,196,048 V326D possibly damaging Het
Zfp641 T A 15: 98,288,717 S342C probably damaging Het
Zfp961 T C 8: 71,969,003 probably benign Het
Other mutations in 4930451G09Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01795:4930451G09Rik APN 16 4974071 exon noncoding transcript
IGL03052:4930451G09Rik APN 16 4977494 splice site noncoding transcript
R0392:4930451G09Rik UTSW 16 4977499 splice site noncoding transcript
R5562:4930451G09Rik UTSW 16 4974076 exon noncoding transcript
R5868:4930451G09Rik UTSW 16 4974068 exon noncoding transcript
Predicted Primers PCR Primer
(F):5'- TGGTCAGTAGCCGCTATGAG -3'
(R):5'- ACCTCCCTGGGAATTCAAGAG -3'

Sequencing Primer
(F):5'- TATGAGCACTGTGATGCGACC -3'
(R):5'- TTCAAGAGGGGTGATAGCCAGTC -3'
Posted On2016-03-01