Incidental Mutation 'R4854:F5'
ID373762
Institutional Source Beutler Lab
Gene Symbol F5
Ensembl Gene ENSMUSG00000026579
Gene Namecoagulation factor V
SynonymsCf-5, Cf5
MMRRC Submission 042465-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4854 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location164151838-164220277 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 164192146 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 730 (A730V)
Ref Sequence ENSEMBL: ENSMUSP00000083204 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000086040]
Predicted Effect probably damaging
Transcript: ENSMUST00000086040
AA Change: A730V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000083204
Gene: ENSMUSG00000026579
AA Change: A730V

DomainStartEndE-ValueType
low complexity region 2 14 N/A INTRINSIC
Pfam:Cu-oxidase_3 67 196 4.4e-10 PFAM
low complexity region 282 300 N/A INTRINSIC
Pfam:Cu-oxidase_3 397 527 1.5e-7 PFAM
low complexity region 1013 1019 N/A INTRINSIC
low complexity region 1045 1058 N/A INTRINSIC
low complexity region 1156 1173 N/A INTRINSIC
low complexity region 1352 1366 N/A INTRINSIC
low complexity region 1368 1382 N/A INTRINSIC
low complexity region 1440 1464 N/A INTRINSIC
Pfam:Cu-oxidase_3 1600 1714 9.1e-8 PFAM
FA58C 1865 2020 8.03e-36 SMART
FA58C 2024 2180 1.96e-30 SMART
Meta Mutation Damage Score 0.148 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.2%
Validation Efficiency 98% (103/105)
MGI Phenotype FUNCTION: This gene encodes a glycoprotein coagulation factor that plays a critical role in the process of blood coagulation and hemostasis. The encoded protein is activated by thrombin, to generate a heterodimer containing heavy and light chains held together by calcium ions. About half of the mice lacking the encoded protein die at an embryonic stage possible due to abnormal yolk-sac vasculature while the remaining animals succumbed to massive hemorrhage immediately after birth. A point mutation in this gene has been shown to cause disseminated intravascular thrombosis in the perinatal period, resulting in frequent deaths of newborn mice. [provided by RefSeq, Apr 2015]
PHENOTYPE: Half of mice homozygous for a null allele die at E9-E10 with defects in yolk-sac vasculature and somite formation; the remaining half develop to term but die of massive hemorrhage within hours of birth. Mice homozygous for a knock-in (F5 Leiden) allele develop strain-specific perinatal thrombosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 94 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810064F22Rik T A 9: 22,208,037 noncoding transcript Het
2700049A03Rik G T 12: 71,164,546 E685* probably null Het
2700049A03Rik A T 12: 71,164,547 E685V possibly damaging Het
Abl1 T C 2: 31,779,010 Y110H probably damaging Het
Ablim2 C T 5: 35,802,422 R73C possibly damaging Het
Agbl3 G A 6: 34,785,284 R73Q probably damaging Het
Agl C T 3: 116,778,618 probably null Het
Amotl1 G A 9: 14,593,451 Q191* probably null Het
Apbb1ip A G 2: 22,853,202 K349E possibly damaging Het
Arhgap10 G A 8: 77,420,089 Q229* probably null Het
Aspm C T 1: 139,478,072 Q1566* probably null Het
B3gnt3 G A 8: 71,692,873 R284C probably damaging Het
Brd4 A G 17: 32,220,237 V423A probably damaging Het
Btbd9 A T 17: 30,524,865 I221N probably damaging Het
Camp A G 9: 109,847,451 V168A probably benign Het
Cd1d2 T A 3: 86,989,249 probably null Het
Cdkn2d A T 9: 21,290,927 V8D probably benign Het
Clec4g T C 8: 3,716,534 N256D probably damaging Het
Clspn A G 4: 126,575,950 I771V probably benign Het
Cntn6 A G 6: 104,859,475 E862G possibly damaging Het
Col6a5 T C 9: 105,898,751 T1702A probably benign Het
Dnah7a T C 1: 53,706,729 probably benign Het
Dubr T C 16: 50,732,523 noncoding transcript Het
Dusp26 G A 8: 31,094,137 V91M probably damaging Het
Edc4 A T 8: 105,887,925 probably benign Het
Foxf1 A G 8: 121,086,814 T358A probably benign Het
Frem1 A T 4: 82,916,758 N1810K possibly damaging Het
Galc A T 12: 98,256,877 F87I probably damaging Het
Gars A G 6: 55,046,418 D66G probably damaging Het
Gbp11 G A 5: 105,325,508 L460F probably damaging Het
Gdf7 T C 12: 8,298,014 I436V probably damaging Het
Gigyf2 C T 1: 87,354,413 probably benign Het
Gm12239 T C 11: 56,015,953 noncoding transcript Het
Gm5592 A C 7: 41,217,471 probably benign Het
Gp2 A T 7: 119,452,199 D264E possibly damaging Het
Gphn G A 12: 78,627,210 V526M probably damaging Het
Grid1 A G 14: 35,321,641 I318V probably benign Het
Grm2 C A 9: 106,654,132 V53F possibly damaging Het
Gtpbp1 T C 15: 79,719,205 S632P probably benign Het
H2-M1 A G 17: 36,670,058 F329L probably benign Het
Hecw1 T A 13: 14,316,892 D92V probably benign Het
Hgh1 T C 15: 76,369,182 L76P probably damaging Het
Idi2 C A 13: 8,957,843 N63K probably benign Het
Ift122 A G 6: 115,862,746 T25A possibly damaging Het
Itgb2l A T 16: 96,426,117 C575* probably null Het
Jup A G 11: 100,383,041 S225P possibly damaging Het
Kcng3 A T 17: 83,588,306 C244S probably damaging Het
Klhl2 T A 8: 64,834,459 M46L possibly damaging Het
Ksr1 A T 11: 79,027,702 I460N probably damaging Het
Lama3 T A 18: 12,411,542 F314Y probably benign Het
Lbp T C 2: 158,327,518 V421A possibly damaging Het
Lcp1 G A 14: 75,200,489 G113D probably damaging Het
Lrp1b A T 2: 41,111,077 L2045H probably damaging Het
Mbd2 G T 18: 70,568,735 D107Y unknown Het
Ms4a14 C T 19: 11,310,369 V96I possibly damaging Het
N4bp2l2 C T 5: 150,662,051 E155K probably benign Het
Nbeal2 T G 9: 110,631,396 H1790P probably damaging Het
Nsg2 G A 11: 32,031,806 G84R probably benign Het
Odf3 A G 7: 140,849,462 Y168C probably damaging Het
Olfr1145 A G 2: 87,810,590 T257A probably damaging Het
Olfr286 A C 15: 98,227,544 F34V possibly damaging Het
P2rx2 T C 5: 110,340,927 N224D probably damaging Het
P2rx5 A T 11: 73,171,779 E438V probably benign Het
Paip1 C A 13: 119,449,889 probably benign Het
Pik3c2g T A 6: 139,768,779 V219E probably damaging Het
Ppp1r12b T C 1: 134,873,951 E509G probably damaging Het
Ppp1r15a T C 7: 45,525,373 S4G probably benign Het
Ppp5c T C 7: 17,009,022 S224G probably benign Het
Prr30 T G 14: 101,198,443 I228L probably benign Het
Purg A G 8: 33,387,314 I327V possibly damaging Het
Ralb T C 1: 119,475,915 T161A probably benign Het
Ripor3 T C 2: 167,992,813 R253G probably benign Het
Scgb2b6 T C 7: 31,617,832 noncoding transcript Het
Setd5 G T 6: 113,151,399 G1438W probably damaging Het
Sh3rf3 T A 10: 58,813,723 L50Q possibly damaging Het
Sipa1l2 G T 8: 125,473,601 T662K probably damaging Het
Skint5 A G 4: 113,580,528 L1021S unknown Het
Slc22a23 T C 13: 34,203,941 S391G probably benign Het
Slc4a5 G A 6: 83,271,017 V402I probably benign Het
Slco4c1 G A 1: 96,841,228 P303L probably damaging Het
Spink5 A T 18: 44,020,841 *1018C probably null Het
Stag3 T A 5: 138,296,694 probably null Het
Tmem117 T C 15: 95,094,688 F410L probably damaging Het
Tmod1 A G 4: 46,090,920 K158E possibly damaging Het
Tpsb2 GGCTGCTGCTGCTGCTG GGCTGCTGCTGCTG 17: 25,366,562 probably benign Het
Traf4 G A 11: 78,161,520 Q100* probably null Het
Trpc4 A G 3: 54,302,218 Y668C probably damaging Het
Ttn T A 2: 76,767,583 N11335I possibly damaging Het
Uhrf1bp1l T G 10: 89,794,484 V382G probably damaging Het
Usp39 A T 6: 72,325,682 V463E probably benign Het
Vmn1r6 A C 6: 57,002,698 Y115S probably benign Het
Vmn2r44 A G 7: 8,380,301 I98T possibly damaging Het
Zfp462 A G 4: 55,010,668 Y878C probably damaging Het
Zfp474 T C 18: 52,638,431 I52T possibly damaging Het
Other mutations in F5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00840:F5 APN 1 164179524 missense probably benign 0.15
IGL00843:F5 APN 1 164211791 missense probably benign 0.00
IGL00904:F5 APN 1 164194009 missense probably benign
IGL00913:F5 APN 1 164204896 missense probably damaging 1.00
IGL01099:F5 APN 1 164194334 missense probably damaging 0.99
IGL01134:F5 APN 1 164191979 missense possibly damaging 0.87
IGL01313:F5 APN 1 164193612 missense probably benign 0.01
IGL01635:F5 APN 1 164207858 missense probably benign 0.00
IGL01697:F5 APN 1 164194052 missense probably benign 0.04
IGL01768:F5 APN 1 164176345 missense probably benign 0.22
IGL01795:F5 APN 1 164194390 missense probably benign 0.00
IGL01835:F5 APN 1 164194368 missense probably benign 0.12
IGL01843:F5 APN 1 164211826 missense probably benign 0.05
IGL01989:F5 APN 1 164176307 missense probably benign 0.39
IGL02036:F5 APN 1 164183002 splice site probably benign
IGL02065:F5 APN 1 164190126 missense probably damaging 1.00
IGL02077:F5 APN 1 164198866 missense probably damaging 1.00
IGL02139:F5 APN 1 164192674 missense possibly damaging 0.89
IGL02210:F5 APN 1 164190141 missense probably benign 0.00
IGL02415:F5 APN 1 164191929 missense probably damaging 1.00
IGL02440:F5 APN 1 164207066 missense possibly damaging 0.79
IGL02471:F5 APN 1 164174291 missense probably damaging 1.00
IGL02535:F5 APN 1 164198733 missense probably damaging 0.98
IGL02537:F5 APN 1 164193117 missense probably benign 0.26
IGL02628:F5 APN 1 164194075 missense probably damaging 0.99
IGL02638:F5 APN 1 164184608 critical splice donor site probably null
IGL02824:F5 APN 1 164194347 missense probably benign 0.00
IGL02977:F5 APN 1 164194021 missense probably damaging 1.00
IGL03028:F5 APN 1 164193000 nonsense probably null
IGL03064:F5 APN 1 164195594 missense probably benign 0.04
IGL03127:F5 APN 1 164193538 missense probably benign 0.45
IGL03131:F5 APN 1 164161819 missense possibly damaging 0.62
IGL03348:F5 APN 1 164194152 missense possibly damaging 0.49
IGL03387:F5 APN 1 164193232 missense probably damaging 1.00
James_dean UTSW 1 164204820 missense probably benign 0.43
R0002:F5 UTSW 1 164201631 missense probably damaging 1.00
R0095:F5 UTSW 1 164191968 nonsense probably null
R0116:F5 UTSW 1 164184914 missense probably benign 0.01
R0359:F5 UTSW 1 164179449 missense probably damaging 1.00
R0426:F5 UTSW 1 164182840 missense probably damaging 0.99
R0452:F5 UTSW 1 164185107 missense probably damaging 0.99
R0457:F5 UTSW 1 164194200 missense probably benign 0.00
R0520:F5 UTSW 1 164209587 missense probably benign 0.15
R0522:F5 UTSW 1 164211763 missense probably damaging 1.00
R0554:F5 UTSW 1 164179449 missense probably damaging 1.00
R0575:F5 UTSW 1 164176244 missense probably damaging 1.00
R0734:F5 UTSW 1 164198917 missense probably damaging 1.00
R0739:F5 UTSW 1 164198917 missense probably damaging 1.00
R1062:F5 UTSW 1 164198917 missense probably damaging 1.00
R1063:F5 UTSW 1 164198917 missense probably damaging 1.00
R1149:F5 UTSW 1 164198917 missense probably damaging 1.00
R1149:F5 UTSW 1 164198917 missense probably damaging 1.00
R1150:F5 UTSW 1 164198917 missense probably damaging 1.00
R1151:F5 UTSW 1 164198917 missense probably damaging 1.00
R1152:F5 UTSW 1 164198917 missense probably damaging 1.00
R1221:F5 UTSW 1 164161799 missense probably damaging 1.00
R1284:F5 UTSW 1 164198917 missense probably damaging 1.00
R1286:F5 UTSW 1 164198917 missense probably damaging 1.00
R1358:F5 UTSW 1 164198917 missense probably damaging 1.00
R1360:F5 UTSW 1 164198917 missense probably damaging 1.00
R1362:F5 UTSW 1 164198917 missense probably damaging 1.00
R1383:F5 UTSW 1 164198917 missense probably damaging 1.00
R1465:F5 UTSW 1 164198833 missense probably benign 0.02
R1465:F5 UTSW 1 164198833 missense probably benign 0.02
R1545:F5 UTSW 1 164208960 nonsense probably null
R1561:F5 UTSW 1 164186903 nonsense probably null
R1623:F5 UTSW 1 164195622 missense probably damaging 1.00
R1662:F5 UTSW 1 164207888 missense probably damaging 1.00
R1673:F5 UTSW 1 164179520 missense probably damaging 1.00
R1689:F5 UTSW 1 164198917 missense probably damaging 1.00
R1705:F5 UTSW 1 164217490 missense possibly damaging 0.92
R1732:F5 UTSW 1 164174150 missense probably damaging 1.00
R1763:F5 UTSW 1 164192535 missense probably benign 0.04
R1774:F5 UTSW 1 164192535 missense probably benign 0.04
R1799:F5 UTSW 1 164193531 missense possibly damaging 0.58
R1800:F5 UTSW 1 164182834 missense probably damaging 1.00
R1842:F5 UTSW 1 164184560 missense probably damaging 0.99
R1915:F5 UTSW 1 164182917 missense probably damaging 0.97
R1926:F5 UTSW 1 164179508 missense probably damaging 1.00
R2025:F5 UTSW 1 164209475 missense probably benign 0.05
R2198:F5 UTSW 1 164207034 missense probably damaging 1.00
R2258:F5 UTSW 1 164192181 missense probably damaging 1.00
R2264:F5 UTSW 1 164194402 missense probably benign 0.32
R2281:F5 UTSW 1 164195720 missense possibly damaging 0.80
R2407:F5 UTSW 1 164211872 missense probably damaging 1.00
R2445:F5 UTSW 1 164190226 missense probably damaging 1.00
R2860:F5 UTSW 1 164184964 missense probably damaging 1.00
R2861:F5 UTSW 1 164184964 missense probably damaging 1.00
R2862:F5 UTSW 1 164184964 missense probably damaging 1.00
R2899:F5 UTSW 1 164186900 missense possibly damaging 0.88
R2910:F5 UTSW 1 164204820 missense probably benign 0.43
R2912:F5 UTSW 1 164193919 missense probably damaging 0.98
R2996:F5 UTSW 1 164182917 missense probably damaging 0.97
R3745:F5 UTSW 1 164186779 missense possibly damaging 0.79
R3901:F5 UTSW 1 164176229 missense probably benign 0.08
R3902:F5 UTSW 1 164176229 missense probably benign 0.08
R4365:F5 UTSW 1 164184950 missense probably damaging 0.98
R4448:F5 UTSW 1 164198899 missense possibly damaging 0.52
R4490:F5 UTSW 1 164217395 missense probably benign 0.40
R4514:F5 UTSW 1 164151997 unclassified probably benign
R4598:F5 UTSW 1 164204797 missense probably benign 0.05
R4608:F5 UTSW 1 164209029 missense probably benign 0.12
R4661:F5 UTSW 1 164184920 missense probably damaging 1.00
R4667:F5 UTSW 1 164174186 missense probably benign 0.00
R4689:F5 UTSW 1 164151973 unclassified probably benign
R4716:F5 UTSW 1 164193919 missense probably damaging 0.98
R4732:F5 UTSW 1 164181657 missense probably damaging 1.00
R4733:F5 UTSW 1 164181657 missense probably damaging 1.00
R4908:F5 UTSW 1 164211820 missense probably damaging 1.00
R4971:F5 UTSW 1 164194186 missense probably benign
R5001:F5 UTSW 1 164195570 missense probably benign 0.00
R5042:F5 UTSW 1 164219451 missense probably damaging 1.00
R5056:F5 UTSW 1 164192032 missense possibly damaging 0.60
R5061:F5 UTSW 1 164194180 missense probably benign 0.00
R5143:F5 UTSW 1 164211828 missense probably damaging 0.98
R5622:F5 UTSW 1 164192565 missense probably benign 0.09
R5626:F5 UTSW 1 164209035 missense probably damaging 0.98
R5658:F5 UTSW 1 164192338 missense probably damaging 0.96
R5702:F5 UTSW 1 164194547 nonsense probably null
R5795:F5 UTSW 1 164152009 missense probably benign 0.09
R5884:F5 UTSW 1 164195646 missense probably benign 0.01
R6036:F5 UTSW 1 164184996 missense probably damaging 0.99
R6036:F5 UTSW 1 164184996 missense probably damaging 0.99
R6151:F5 UTSW 1 164181635 missense probably damaging 1.00
R6151:F5 UTSW 1 164190187 missense probably damaging 1.00
R6345:F5 UTSW 1 164191951 missense probably benign 0.13
R6391:F5 UTSW 1 164193493 missense probably damaging 0.99
R6542:F5 UTSW 1 164194468 missense probably benign 0.32
R6620:F5 UTSW 1 164186806 missense probably damaging 1.00
R6750:F5 UTSW 1 164193507 missense possibly damaging 0.58
R6754:F5 UTSW 1 164193763 missense probably damaging 1.00
R6774:F5 UTSW 1 164186878 missense probably damaging 1.00
R6802:F5 UTSW 1 164179356 missense probably damaging 0.98
R6810:F5 UTSW 1 164186902 missense probably damaging 1.00
R6983:F5 UTSW 1 164194129 missense probably damaging 1.00
R7000:F5 UTSW 1 164179506 missense probably damaging 1.00
R7151:F5 UTSW 1 164201661 missense probably damaging 1.00
R7193:F5 UTSW 1 164219397 missense probably damaging 1.00
R7230:F5 UTSW 1 164184953 missense probably benign
X0024:F5 UTSW 1 164192988 missense probably damaging 1.00
Z1088:F5 UTSW 1 164154385 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- GTTGACCACCATGAATTCCAATC -3'
(R):5'- GCCAGGAAGTGTTCTTTGAAAGTC -3'

Sequencing Primer
(F):5'- CGCAGAAACCTAAGACTGAGATTC -3'
(R):5'- AAGTGTTCTTTGAAAGTCTTTGAGG -3'
Posted On2016-03-01