Incidental Mutation 'R4854:P2rx2'
ID373777
Institutional Source Beutler Lab
Gene Symbol P2rx2
Ensembl Gene ENSMUSG00000029503
Gene Namepurinergic receptor P2X, ligand-gated ion channel, 2
SynonymsP2x2, P2X2a
MMRRC Submission 042465-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4854 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location110339812-110343212 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 110340927 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Aspartic acid at position 224 (N224D)
Ref Sequence ENSEMBL: ENSMUSP00000142567 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000007296] [ENSMUST00000058016] [ENSMUST00000112478] [ENSMUST00000112481] [ENSMUST00000185691] [ENSMUST00000186408] [ENSMUST00000195985] [ENSMUST00000200037] [ENSMUST00000200214]
Predicted Effect probably benign
Transcript: ENSMUST00000007296
SMART Domains Protein: ENSMUSP00000007296
Gene: ENSMUSG00000007080

DomainStartEndE-ValueType
POLBc 267 870 9.42e-97 SMART
Blast:POLBc 903 970 1e-28 BLAST
Blast:POLBc 1014 1073 2e-22 BLAST
Blast:POLBc 1195 1266 7e-21 BLAST
low complexity region 1275 1294 N/A INTRINSIC
Blast:DUF1744 1401 1430 2e-7 BLAST
DUF1744 1524 1924 1.9e-236 SMART
coiled coil region 1936 1963 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000058016
AA Change: N323D

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000054233
Gene: ENSMUSG00000029503
AA Change: N323D

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
Pfam:P2X_receptor 27 388 1.5e-149 PFAM
low complexity region 419 436 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000112478
AA Change: N311D

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000108097
Gene: ENSMUSG00000029503
AA Change: N311D

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
Pfam:P2X_receptor 27 395 4e-144 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000112481
SMART Domains Protein: ENSMUSP00000108100
Gene: ENSMUSG00000007080

DomainStartEndE-ValueType
Pfam:DUF1744 13 48 2.7e-13 PFAM
coiled coil region 60 87 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141506
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152495
Predicted Effect probably benign
Transcript: ENSMUST00000185691
SMART Domains Protein: ENSMUSP00000139397
Gene: ENSMUSG00000072754

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:Colipase-like 26 85 3.8e-19 PFAM
Pfam:Colipase-like 66 155 3.2e-35 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000186408
Predicted Effect noncoding transcript
Transcript: ENSMUST00000190060
Predicted Effect probably damaging
Transcript: ENSMUST00000195985
AA Change: N311D

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000143047
Gene: ENSMUSG00000029503
AA Change: N311D

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
Pfam:P2X_receptor 27 393 7.4e-144 PFAM
low complexity region 419 436 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199165
Predicted Effect probably damaging
Transcript: ENSMUST00000200037
AA Change: N311D

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000143554
Gene: ENSMUSG00000029503
AA Change: N311D

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
Pfam:P2X_receptor 27 388 5.5e-149 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000200214
AA Change: N224D

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000142567
Gene: ENSMUSG00000029503
AA Change: N224D

DomainStartEndE-ValueType
Pfam:P2X_receptor 1 306 1.3e-117 PFAM
low complexity region 332 349 N/A INTRINSIC
Meta Mutation Damage Score 0.106 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.2%
Validation Efficiency 98% (103/105)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene belongs to the family of purinoceptors for ATP. This receptor functions as a ligand-gated ion channel. Binding to ATP mediates synaptic transmission between neurons and from neurons to smooth muscle. Multiple transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Aug 2013]
PHENOTYPE: Homozygous mutant mice are viable and show no gross pathology. Mice show abnormal ventilatory and electrophysiological responses to hypoxia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 94 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810064F22Rik T A 9: 22,208,037 noncoding transcript Het
2700049A03Rik G T 12: 71,164,546 E685* probably null Het
2700049A03Rik A T 12: 71,164,547 E685V possibly damaging Het
Abl1 T C 2: 31,779,010 Y110H probably damaging Het
Ablim2 C T 5: 35,802,422 R73C possibly damaging Het
Agbl3 G A 6: 34,785,284 R73Q probably damaging Het
Agl C T 3: 116,778,618 probably null Het
Amotl1 G A 9: 14,593,451 Q191* probably null Het
Apbb1ip A G 2: 22,853,202 K349E possibly damaging Het
Arhgap10 G A 8: 77,420,089 Q229* probably null Het
Aspm C T 1: 139,478,072 Q1566* probably null Het
B3gnt3 G A 8: 71,692,873 R284C probably damaging Het
Brd4 A G 17: 32,220,237 V423A probably damaging Het
Btbd9 A T 17: 30,524,865 I221N probably damaging Het
Camp A G 9: 109,847,451 V168A probably benign Het
Cd1d2 T A 3: 86,989,249 probably null Het
Cdkn2d A T 9: 21,290,927 V8D probably benign Het
Clec4g T C 8: 3,716,534 N256D probably damaging Het
Clspn A G 4: 126,575,950 I771V probably benign Het
Cntn6 A G 6: 104,859,475 E862G possibly damaging Het
Col6a5 T C 9: 105,898,751 T1702A probably benign Het
Dnah7a T C 1: 53,706,729 probably benign Het
Dubr T C 16: 50,732,523 noncoding transcript Het
Dusp26 G A 8: 31,094,137 V91M probably damaging Het
Edc4 A T 8: 105,887,925 probably benign Het
F5 C T 1: 164,192,146 A730V probably damaging Het
Foxf1 A G 8: 121,086,814 T358A probably benign Het
Frem1 A T 4: 82,916,758 N1810K possibly damaging Het
Galc A T 12: 98,256,877 F87I probably damaging Het
Gars A G 6: 55,046,418 D66G probably damaging Het
Gbp11 G A 5: 105,325,508 L460F probably damaging Het
Gdf7 T C 12: 8,298,014 I436V probably damaging Het
Gigyf2 C T 1: 87,354,413 probably benign Het
Gm12239 T C 11: 56,015,953 noncoding transcript Het
Gm5592 A C 7: 41,217,471 probably benign Het
Gp2 A T 7: 119,452,199 D264E possibly damaging Het
Gphn G A 12: 78,627,210 V526M probably damaging Het
Grid1 A G 14: 35,321,641 I318V probably benign Het
Grm2 C A 9: 106,654,132 V53F possibly damaging Het
Gtpbp1 T C 15: 79,719,205 S632P probably benign Het
H2-M1 A G 17: 36,670,058 F329L probably benign Het
Hecw1 T A 13: 14,316,892 D92V probably benign Het
Hgh1 T C 15: 76,369,182 L76P probably damaging Het
Idi2 C A 13: 8,957,843 N63K probably benign Het
Ift122 A G 6: 115,862,746 T25A possibly damaging Het
Itgb2l A T 16: 96,426,117 C575* probably null Het
Jup A G 11: 100,383,041 S225P possibly damaging Het
Kcng3 A T 17: 83,588,306 C244S probably damaging Het
Klhl2 T A 8: 64,834,459 M46L possibly damaging Het
Ksr1 A T 11: 79,027,702 I460N probably damaging Het
Lama3 T A 18: 12,411,542 F314Y probably benign Het
Lbp T C 2: 158,327,518 V421A possibly damaging Het
Lcp1 G A 14: 75,200,489 G113D probably damaging Het
Lrp1b A T 2: 41,111,077 L2045H probably damaging Het
Mbd2 G T 18: 70,568,735 D107Y unknown Het
Ms4a14 C T 19: 11,310,369 V96I possibly damaging Het
N4bp2l2 C T 5: 150,662,051 E155K probably benign Het
Nbeal2 T G 9: 110,631,396 H1790P probably damaging Het
Nsg2 G A 11: 32,031,806 G84R probably benign Het
Odf3 A G 7: 140,849,462 Y168C probably damaging Het
Olfr1145 A G 2: 87,810,590 T257A probably damaging Het
Olfr286 A C 15: 98,227,544 F34V possibly damaging Het
P2rx5 A T 11: 73,171,779 E438V probably benign Het
Paip1 C A 13: 119,449,889 probably benign Het
Pik3c2g T A 6: 139,768,779 V219E probably damaging Het
Ppp1r12b T C 1: 134,873,951 E509G probably damaging Het
Ppp1r15a T C 7: 45,525,373 S4G probably benign Het
Ppp5c T C 7: 17,009,022 S224G probably benign Het
Prr30 T G 14: 101,198,443 I228L probably benign Het
Purg A G 8: 33,387,314 I327V possibly damaging Het
Ralb T C 1: 119,475,915 T161A probably benign Het
Ripor3 T C 2: 167,992,813 R253G probably benign Het
Scgb2b6 T C 7: 31,617,832 noncoding transcript Het
Setd5 G T 6: 113,151,399 G1438W probably damaging Het
Sh3rf3 T A 10: 58,813,723 L50Q possibly damaging Het
Sipa1l2 G T 8: 125,473,601 T662K probably damaging Het
Skint5 A G 4: 113,580,528 L1021S unknown Het
Slc22a23 T C 13: 34,203,941 S391G probably benign Het
Slc4a5 G A 6: 83,271,017 V402I probably benign Het
Slco4c1 G A 1: 96,841,228 P303L probably damaging Het
Spink5 A T 18: 44,020,841 *1018C probably null Het
Stag3 T A 5: 138,296,694 probably null Het
Tmem117 T C 15: 95,094,688 F410L probably damaging Het
Tmod1 A G 4: 46,090,920 K158E possibly damaging Het
Tpsb2 GGCTGCTGCTGCTGCTG GGCTGCTGCTGCTG 17: 25,366,562 probably benign Het
Traf4 G A 11: 78,161,520 Q100* probably null Het
Trpc4 A G 3: 54,302,218 Y668C probably damaging Het
Ttn T A 2: 76,767,583 N11335I possibly damaging Het
Uhrf1bp1l T G 10: 89,794,484 V382G probably damaging Het
Usp39 A T 6: 72,325,682 V463E probably benign Het
Vmn1r6 A C 6: 57,002,698 Y115S probably benign Het
Vmn2r44 A G 7: 8,380,301 I98T possibly damaging Het
Zfp462 A G 4: 55,010,668 Y878C probably damaging Het
Zfp474 T C 18: 52,638,431 I52T possibly damaging Het
Other mutations in P2rx2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02332:P2rx2 APN 5 110341805 missense probably benign 0.22
IGL02523:P2rx2 APN 5 110342042 missense probably damaging 0.98
IGL02535:P2rx2 APN 5 110342353 missense probably benign 0.02
IGL02663:P2rx2 APN 5 110340249 missense possibly damaging 0.84
IGL02663:P2rx2 APN 5 110340186 unclassified probably null
IGL02756:P2rx2 APN 5 110342410 splice site probably benign
IGL03177:P2rx2 APN 5 110341613 missense probably damaging 1.00
R0382:P2rx2 UTSW 5 110341179 missense probably benign 0.25
R2092:P2rx2 UTSW 5 110341141 missense probably damaging 1.00
R2104:P2rx2 UTSW 5 110341141 missense probably damaging 1.00
R2226:P2rx2 UTSW 5 110342879 missense probably damaging 0.98
R2395:P2rx2 UTSW 5 110341661 missense probably damaging 1.00
R4863:P2rx2 UTSW 5 110341568 missense probably benign 0.23
R5125:P2rx2 UTSW 5 110342651 missense possibly damaging 0.59
R5250:P2rx2 UTSW 5 110341588 missense probably damaging 0.98
R5366:P2rx2 UTSW 5 110341828 missense probably damaging 1.00
R5559:P2rx2 UTSW 5 110340561 missense possibly damaging 0.90
R5827:P2rx2 UTSW 5 110340329 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- ACTGAATTTCCCTGCCTGTAG -3'
(R):5'- TTCAGGCTACAACTTCAGGTACC -3'

Sequencing Primer
(F):5'- GAATTTCCCTGCCTGTAGACAAC -3'
(R):5'- CTTGTTCTGGATCCATGACAGACAG -3'
Posted On2016-03-01