Incidental Mutation 'R4854:Ift122'
ID373786
Institutional Source Beutler Lab
Gene Symbol Ift122
Ensembl Gene ENSMUSG00000030323
Gene Nameintraflagellar transport 122
SynonymsC86139, sopb, Wdr10
MMRRC Submission 042465-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4854 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location115853470-115926699 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 115862746 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 25 (T25A)
Ref Sequence ENSEMBL: ENSMUSP00000138535 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038234] [ENSMUST00000112923] [ENSMUST00000112925] [ENSMUST00000141305]
Predicted Effect probably benign
Transcript: ENSMUST00000038234
AA Change: T25A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000045468
Gene: ENSMUSG00000030323
AA Change: T25A

DomainStartEndE-ValueType
WD40 1 39 7.1e1 SMART
WD40 42 81 7.16e-10 SMART
WD40 83 120 1.54e0 SMART
WD40 122 160 1.43e0 SMART
WD40 162 208 2.29e1 SMART
WD40 210 249 1.91e1 SMART
WD40 251 290 3.45e-3 SMART
WD40 448 483 1.43e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000112923
AA Change: T25A

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000108545
Gene: ENSMUSG00000030323
AA Change: T25A

DomainStartEndE-ValueType
WD40 1 39 7.1e1 SMART
WD40 42 81 7.16e-10 SMART
WD40 83 120 1.54e0 SMART
WD40 122 160 1.43e0 SMART
Blast:WD40 163 267 3e-46 BLAST
WD40 269 308 1.91e1 SMART
WD40 310 349 3.45e-3 SMART
WD40 507 542 1.43e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000112925
AA Change: T25A

PolyPhen 2 Score 0.114 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000108547
Gene: ENSMUSG00000030323
AA Change: T25A

DomainStartEndE-ValueType
WD40 1 39 7.1e1 SMART
WD40 42 81 7.16e-10 SMART
WD40 83 120 1.54e0 SMART
WD40 122 160 1.43e0 SMART
WD40 162 208 2.29e1 SMART
WD40 210 249 1.91e1 SMART
WD40 251 290 3.45e-3 SMART
WD40 448 483 1.43e1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125889
Predicted Effect possibly damaging
Transcript: ENSMUST00000141305
AA Change: T25A

PolyPhen 2 Score 0.613 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000138535
Gene: ENSMUSG00000030323
AA Change: T25A

DomainStartEndE-ValueType
WD40 1 39 7.1e1 SMART
WD40 42 81 7.16e-10 SMART
WD40 83 120 1.54e0 SMART
low complexity region 124 134 N/A INTRINSIC
low complexity region 162 176 N/A INTRINSIC
Meta Mutation Damage Score 0.15 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.2%
Validation Efficiency 98% (103/105)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the WD repeat protein family. WD repeats are minimally conserved regions of approximately 40 amino acids typically bracketed by gly-his and trp-asp (GH-WD), which may facilitate formation of heterotrimeric or multiprotein complexes. Members of this family are involved in a variety of cellular processes, including cell cycle progression, signal transduction, apoptosis, and gene regulation. This cytoplasmic protein contains seven WD repeats and an AF-2 domain which function by recruiting coregulatory molecules and in transcriptional activation. Mutations in this gene cause cranioectodermal dysplasia-1. A related pseudogene is located on chromosome 3. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2013]
PHENOTYPE: Homozygotes for a null mutation display embryonic lethality during organogenesis with exencephaly, a ventralized caudal neural tube, preaxial polydactyly, abnormal cilia, and left-right patterning defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 94 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810064F22Rik T A 9: 22,208,037 noncoding transcript Het
2700049A03Rik G T 12: 71,164,546 E685* probably null Het
2700049A03Rik A T 12: 71,164,547 E685V possibly damaging Het
Abl1 T C 2: 31,779,010 Y110H probably damaging Het
Ablim2 C T 5: 35,802,422 R73C possibly damaging Het
Agbl3 G A 6: 34,785,284 R73Q probably damaging Het
Agl C T 3: 116,778,618 probably null Het
Amotl1 G A 9: 14,593,451 Q191* probably null Het
Apbb1ip A G 2: 22,853,202 K349E possibly damaging Het
Arhgap10 G A 8: 77,420,089 Q229* probably null Het
Aspm C T 1: 139,478,072 Q1566* probably null Het
B3gnt3 G A 8: 71,692,873 R284C probably damaging Het
Brd4 A G 17: 32,220,237 V423A probably damaging Het
Btbd9 A T 17: 30,524,865 I221N probably damaging Het
Camp A G 9: 109,847,451 V168A probably benign Het
Cd1d2 T A 3: 86,989,249 probably null Het
Cdkn2d A T 9: 21,290,927 V8D probably benign Het
Clec4g T C 8: 3,716,534 N256D probably damaging Het
Clspn A G 4: 126,575,950 I771V probably benign Het
Cntn6 A G 6: 104,859,475 E862G possibly damaging Het
Col6a5 T C 9: 105,898,751 T1702A probably benign Het
Dnah7a T C 1: 53,706,729 probably benign Het
Dubr T C 16: 50,732,523 noncoding transcript Het
Dusp26 G A 8: 31,094,137 V91M probably damaging Het
Edc4 A T 8: 105,887,925 probably benign Het
F5 C T 1: 164,192,146 A730V probably damaging Het
Foxf1 A G 8: 121,086,814 T358A probably benign Het
Frem1 A T 4: 82,916,758 N1810K possibly damaging Het
Galc A T 12: 98,256,877 F87I probably damaging Het
Gars A G 6: 55,046,418 D66G probably damaging Het
Gbp11 G A 5: 105,325,508 L460F probably damaging Het
Gdf7 T C 12: 8,298,014 I436V probably damaging Het
Gigyf2 C T 1: 87,354,413 probably benign Het
Gm12239 T C 11: 56,015,953 noncoding transcript Het
Gm5592 A C 7: 41,217,471 probably benign Het
Gp2 A T 7: 119,452,199 D264E possibly damaging Het
Gphn G A 12: 78,627,210 V526M probably damaging Het
Grid1 A G 14: 35,321,641 I318V probably benign Het
Grm2 C A 9: 106,654,132 V53F possibly damaging Het
Gtpbp1 T C 15: 79,719,205 S632P probably benign Het
H2-M1 A G 17: 36,670,058 F329L probably benign Het
Hecw1 T A 13: 14,316,892 D92V probably benign Het
Hgh1 T C 15: 76,369,182 L76P probably damaging Het
Idi2 C A 13: 8,957,843 N63K probably benign Het
Itgb2l A T 16: 96,426,117 C575* probably null Het
Jup A G 11: 100,383,041 S225P possibly damaging Het
Kcng3 A T 17: 83,588,306 C244S probably damaging Het
Klhl2 T A 8: 64,834,459 M46L possibly damaging Het
Ksr1 A T 11: 79,027,702 I460N probably damaging Het
Lama3 T A 18: 12,411,542 F314Y probably benign Het
Lbp T C 2: 158,327,518 V421A possibly damaging Het
Lcp1 G A 14: 75,200,489 G113D probably damaging Het
Lrp1b A T 2: 41,111,077 L2045H probably damaging Het
Mbd2 G T 18: 70,568,735 D107Y unknown Het
Ms4a14 C T 19: 11,310,369 V96I possibly damaging Het
N4bp2l2 C T 5: 150,662,051 E155K probably benign Het
Nbeal2 T G 9: 110,631,396 H1790P probably damaging Het
Nsg2 G A 11: 32,031,806 G84R probably benign Het
Odf3 A G 7: 140,849,462 Y168C probably damaging Het
Olfr1145 A G 2: 87,810,590 T257A probably damaging Het
Olfr286 A C 15: 98,227,544 F34V possibly damaging Het
P2rx2 T C 5: 110,340,927 N224D probably damaging Het
P2rx5 A T 11: 73,171,779 E438V probably benign Het
Paip1 C A 13: 119,449,889 probably benign Het
Pik3c2g T A 6: 139,768,779 V219E probably damaging Het
Ppp1r12b T C 1: 134,873,951 E509G probably damaging Het
Ppp1r15a T C 7: 45,525,373 S4G probably benign Het
Ppp5c T C 7: 17,009,022 S224G probably benign Het
Prr30 T G 14: 101,198,443 I228L probably benign Het
Purg A G 8: 33,387,314 I327V possibly damaging Het
Ralb T C 1: 119,475,915 T161A probably benign Het
Ripor3 T C 2: 167,992,813 R253G probably benign Het
Scgb2b6 T C 7: 31,617,832 noncoding transcript Het
Setd5 G T 6: 113,151,399 G1438W probably damaging Het
Sh3rf3 T A 10: 58,813,723 L50Q possibly damaging Het
Sipa1l2 G T 8: 125,473,601 T662K probably damaging Het
Skint5 A G 4: 113,580,528 L1021S unknown Het
Slc22a23 T C 13: 34,203,941 S391G probably benign Het
Slc4a5 G A 6: 83,271,017 V402I probably benign Het
Slco4c1 G A 1: 96,841,228 P303L probably damaging Het
Spink5 A T 18: 44,020,841 *1018C probably null Het
Stag3 T A 5: 138,296,694 probably null Het
Tmem117 T C 15: 95,094,688 F410L probably damaging Het
Tmod1 A G 4: 46,090,920 K158E possibly damaging Het
Tpsb2 GGCTGCTGCTGCTGCTG GGCTGCTGCTGCTG 17: 25,366,562 probably benign Het
Traf4 G A 11: 78,161,520 Q100* probably null Het
Trpc4 A G 3: 54,302,218 Y668C probably damaging Het
Ttn T A 2: 76,767,583 N11335I possibly damaging Het
Uhrf1bp1l T G 10: 89,794,484 V382G probably damaging Het
Usp39 A T 6: 72,325,682 V463E probably benign Het
Vmn1r6 A C 6: 57,002,698 Y115S probably benign Het
Vmn2r44 A G 7: 8,380,301 I98T possibly damaging Het
Zfp462 A G 4: 55,010,668 Y878C probably damaging Het
Zfp474 T C 18: 52,638,431 I52T possibly damaging Het
Other mutations in Ift122
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00227:Ift122 APN 6 115917057 missense probably benign 0.10
IGL00783:Ift122 APN 6 115905902 missense probably benign
IGL00784:Ift122 APN 6 115905902 missense probably benign
IGL00799:Ift122 APN 6 115877536 missense probably damaging 1.00
IGL00908:Ift122 APN 6 115913909 missense probably benign 0.00
IGL01012:Ift122 APN 6 115899491 missense probably damaging 0.99
IGL01444:Ift122 APN 6 115884379 missense probably benign 0.08
IGL01451:Ift122 APN 6 115912604 critical splice donor site probably null
IGL01940:Ift122 APN 6 115887371 splice site probably benign
IGL02089:Ift122 APN 6 115925437 missense probably benign 0.00
IGL02331:Ift122 APN 6 115887324 missense probably damaging 1.00
IGL02929:Ift122 APN 6 115902877 missense probably damaging 1.00
IGL03169:Ift122 APN 6 115905961 splice site probably benign
PIT1430001:Ift122 UTSW 6 115925744 splice site probably benign
R0158:Ift122 UTSW 6 115924484 splice site probably benign
R0496:Ift122 UTSW 6 115905902 missense probably benign
R1065:Ift122 UTSW 6 115875325 splice site probably null
R1670:Ift122 UTSW 6 115923883 missense probably benign 0.05
R1861:Ift122 UTSW 6 115891928 missense probably damaging 1.00
R1889:Ift122 UTSW 6 115894421 critical splice donor site probably null
R1990:Ift122 UTSW 6 115924367 missense probably damaging 1.00
R2362:Ift122 UTSW 6 115884350 missense probably damaging 0.99
R2385:Ift122 UTSW 6 115912522 missense probably benign 0.21
R3734:Ift122 UTSW 6 115925501 splice site probably benign
R3800:Ift122 UTSW 6 115925906 missense probably benign 0.03
R3981:Ift122 UTSW 6 115913921 missense probably benign 0.02
R4289:Ift122 UTSW 6 115923891 missense probably damaging 1.00
R4545:Ift122 UTSW 6 115890588 missense probably damaging 1.00
R4546:Ift122 UTSW 6 115890588 missense probably damaging 1.00
R4641:Ift122 UTSW 6 115888765 nonsense probably null
R4815:Ift122 UTSW 6 115881556 missense possibly damaging 0.95
R4928:Ift122 UTSW 6 115915858 utr 3 prime probably benign
R5021:Ift122 UTSW 6 115864372 missense probably benign 0.41
R5121:Ift122 UTSW 6 115912534 missense probably benign 0.04
R5200:Ift122 UTSW 6 115920379 missense probably damaging 0.99
R5549:Ift122 UTSW 6 115892022 missense probably damaging 1.00
R6111:Ift122 UTSW 6 115875286 missense probably damaging 1.00
R6141:Ift122 UTSW 6 115916011 missense probably damaging 0.99
R6766:Ift122 UTSW 6 115926243 missense probably benign 0.15
R7379:Ift122 UTSW 6 115926302 missense probably benign
R7402:Ift122 UTSW 6 115894322 missense probably benign 0.00
R7436:Ift122 UTSW 6 115926302 missense probably benign
R7437:Ift122 UTSW 6 115926302 missense probably benign
R7438:Ift122 UTSW 6 115926302 missense probably benign
Predicted Primers PCR Primer
(F):5'- TGAGTGGAATTTGCAACCAGAG -3'
(R):5'- GCATTGCTCATGGGTTCCTATC -3'

Sequencing Primer
(F):5'- TGCAACCAGAGACAATTTTTAGCC -3'
(R):5'- CTCATGGGTTCCTATCTGATAGACAG -3'
Posted On2016-03-01