Incidental Mutation 'R4855:Sbspon'
ID373845
Institutional Source Beutler Lab
Gene Symbol Sbspon
Ensembl Gene ENSMUSG00000032719
Gene Namesomatomedin B and thrombospondin, type 1 domain containing
SynonymsGm106, LOC226866
MMRRC Submission 042466-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.137) question?
Stock #R4855 (G1)
Quality Score221
Status Validated
Chromosome1
Chromosomal Location15853862-15892722 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 15859040 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 176 (S176T)
Ref Sequence ENSEMBL: ENSMUSP00000047730 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040695]
Predicted Effect possibly damaging
Transcript: ENSMUST00000040695
AA Change: S176T

PolyPhen 2 Score 0.941 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000047730
Gene: ENSMUSG00000032719
AA Change: S176T

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Blast:SO 25 74 2e-13 BLAST
TSP1 77 133 4.82e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194867
Meta Mutation Damage Score 0.172 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.5%
Validation Efficiency 98% (93/95)
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik G T 12: 71,164,546 E685* probably null Het
2700049A03Rik A T 12: 71,164,547 E685V possibly damaging Het
4921501E09Rik C T 17: 33,066,739 S363N probably benign Het
Ablim2 C T 5: 35,802,422 R73C possibly damaging Het
Adad1 G T 3: 37,085,111 L443F probably damaging Het
Amph T A 13: 19,084,208 M70K probably damaging Het
Ankra2 T A 13: 98,273,411 L306H probably damaging Het
Arc A C 15: 74,671,743 D210E probably benign Het
Arhgap10 A G 8: 77,432,738 probably null Het
Atp8b5 T A 4: 43,344,449 N445K probably benign Het
C1qc G T 4: 136,890,435 Q117K probably benign Het
Cadps T A 14: 12,822,449 E97V unknown Het
Capn13 GCA G 17: 73,351,506 probably null Het
Cdk13 A T 13: 17,721,283 W1014R probably damaging Het
Cltb C T 13: 54,599,095 E23K probably damaging Het
Clvs2 A T 10: 33,622,646 I96N probably damaging Het
Cwf19l1 A G 19: 44,114,567 V403A probably damaging Het
Ddr2 A T 1: 169,988,497 L547Q possibly damaging Het
Ebf1 A T 11: 44,972,908 K354* probably null Het
Fam208b A T 13: 3,566,680 probably null Het
Fat4 A G 3: 38,888,317 Q453R probably benign Het
Gas2l3 CACTCGTCATACT CACT 10: 89,430,958 probably benign Het
Gata6 A G 18: 11,054,497 E142G possibly damaging Het
Gm14221 T C 2: 160,574,680 noncoding transcript Het
Gm42791 C A 5: 148,959,437 probably benign Het
Gm6370 G T 5: 146,493,811 V269L probably benign Het
Gphn G A 12: 78,627,210 V526M probably damaging Het
Gpt A T 15: 76,699,285 E206V probably damaging Het
Grm3 G A 5: 9,570,047 A399V probably damaging Het
Helq A T 5: 100,783,159 V575E possibly damaging Het
Herc4 A G 10: 63,315,658 probably null Het
Ifi207 A T 1: 173,729,815 N452K probably damaging Het
Ikbke A G 1: 131,257,111 probably null Het
Kbtbd2 A G 6: 56,779,702 F350L probably benign Het
Kmt2c A G 5: 25,314,557 V2185A probably benign Het
Lgi2 T C 5: 52,538,507 Q362R probably damaging Het
Lrit1 G A 14: 37,061,816 G367E possibly damaging Het
Lrp1 G A 10: 127,610,442 H78Y probably benign Het
Matk A G 10: 81,262,886 probably benign Het
Med21 G A 6: 146,648,192 G24S probably damaging Het
Met G T 6: 17,558,797 L1141F probably damaging Het
Mroh3 A T 1: 136,200,939 probably null Het
Mrpl15 T C 1: 4,774,460 I203V probably benign Het
Naip1 T C 13: 100,423,220 probably null Het
Ndufa9 A C 6: 126,827,542 Y298* probably null Het
Neb T C 2: 52,298,894 E808G probably damaging Het
Nol4l C T 2: 153,411,806 G616S probably benign Het
Olfr1290 T G 2: 111,489,948 D70A probably damaging Het
Olfr1306 A G 2: 111,912,099 V277A probably benign Het
Olfr676 T A 7: 105,035,651 I151N probably damaging Het
Olfr700 T C 7: 106,806,256 M69V probably benign Het
Olfr988 T C 2: 85,353,449 N159S possibly damaging Het
Oprm1 T A 10: 6,838,468 C408S probably benign Het
Paqr3 A G 5: 97,108,194 I107T possibly damaging Het
Pex5l G A 3: 33,142,840 probably benign Het
Pik3ap1 T C 19: 41,327,845 D326G probably benign Het
Plaa G T 4: 94,586,408 D252E probably damaging Het
Plxna2 G A 1: 194,797,732 V1404I probably benign Het
Ppargc1a G A 5: 51,474,222 A355V possibly damaging Het
Primpol A G 8: 46,586,691 S350P probably benign Het
Prlr T C 15: 10,328,797 S453P probably benign Het
Psmd5 T C 2: 34,852,552 probably benign Het
Robo2 A T 16: 73,971,191 V571E probably damaging Het
Scyl2 G A 10: 89,640,463 probably benign Het
Sema3e T A 5: 14,230,130 V341E probably damaging Het
Serpinb3b A T 1: 107,154,540 F331L possibly damaging Het
Setd2 A G 9: 110,571,954 H1736R probably benign Het
Sidt2 A T 9: 45,952,029 D180E probably benign Het
Skint9 A T 4: 112,391,011 Y179N probably benign Het
Slc27a5 T C 7: 12,988,633 N638S probably benign Het
Slc6a4 T A 11: 77,013,309 W197R probably damaging Het
Spag17 A T 3: 100,063,333 M1278L probably benign Het
Sptbn1 T A 11: 30,142,353 I471F probably damaging Het
Teddm1a A G 1: 153,892,636 Q282R probably benign Het
Tex35 A G 1: 157,099,725 L160P probably damaging Het
Tfap2c T C 2: 172,551,518 Y118H probably damaging Het
Tpp1 T C 7: 105,746,723 Q533R probably benign Het
Ttc13 C T 8: 124,674,435 D730N probably damaging Het
Ufc1 A G 1: 171,294,802 probably benign Het
Vcpip1 A G 1: 9,747,364 W265R probably damaging Het
Wdr11 C G 7: 129,600,434 probably null Het
Xirp2 A G 2: 67,511,064 I1216M possibly damaging Het
Zswim2 A G 2: 83,916,843 probably null Het
Other mutations in Sbspon
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01951:Sbspon APN 1 15858934 missense probably benign 0.24
IGL02213:Sbspon APN 1 15858926 missense probably benign 0.02
IGL02929:Sbspon APN 1 15883845 splice site probably benign
R1580:Sbspon UTSW 1 15892468 missense probably damaging 1.00
R1647:Sbspon UTSW 1 15883759 missense probably damaging 1.00
R1648:Sbspon UTSW 1 15883759 missense probably damaging 1.00
R1952:Sbspon UTSW 1 15860295 missense probably damaging 1.00
R3105:Sbspon UTSW 1 15892582 missense probably benign 0.06
R3106:Sbspon UTSW 1 15892582 missense probably benign 0.06
R3712:Sbspon UTSW 1 15892445 missense probably damaging 0.97
R4850:Sbspon UTSW 1 15858968 missense probably damaging 0.98
R6374:Sbspon UTSW 1 15883663 missense probably benign
R6953:Sbspon UTSW 1 15860295 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- CCTCAGGATAAGCAGAAAACTATGTC -3'
(R):5'- ACGATCAGATCCTCAGGCTG -3'

Sequencing Primer
(F):5'- CAGTTGTCCTTCCTTACCCATCAGAG -3'
(R):5'- GGCACTGTGACACATCTGTAATGC -3'
Posted On2016-03-01