Incidental Mutation 'R4855:Pex5l'
ID373863
Institutional Source Beutler Lab
Gene Symbol Pex5l
Ensembl Gene ENSMUSG00000027674
Gene Nameperoxisomal biogenesis factor 5-like
SynonymsPex2, PXR2, TRIP8b, 1700016J08Rik
MMRRC Submission 042466-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.432) question?
Stock #R4855 (G1)
Quality Score165
Status Validated
Chromosome3
Chromosomal Location32949408-33143247 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) G to A at 33142840 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000103861 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000108226]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000108219
SMART Domains Protein: ENSMUSP00000103854
Gene: ENSMUSG00000027674

DomainStartEndE-ValueType
low complexity region 124 140 N/A INTRINSIC
low complexity region 226 240 N/A INTRINSIC
PDB:4EQF|A 266 362 8e-64 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000108226
SMART Domains Protein: ENSMUSP00000103861
Gene: ENSMUSG00000027674

DomainStartEndE-ValueType
low complexity region 65 81 N/A INTRINSIC
low complexity region 166 180 N/A INTRINSIC
TPR 301 334 6.95e-4 SMART
Blast:TPR 335 368 2e-14 BLAST
TPR 415 448 3.19e-3 SMART
TPR 449 482 3.47e-4 SMART
TPR 483 516 1.1e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155264
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194627
Meta Mutation Damage Score 0.0656 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.5%
Validation Efficiency 98% (93/95)
MGI Phenotype PHENOTYPE: Mice homozygous for a targeted mutation lacking isoform b exhibit exhibit reduced hyperpolarization-activated current in CA1 pyramidal neuron, impaired motor learning, impaired nest-building, decreased startle reflex, and decreased depression-related behaviors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik G T 12: 71,164,546 E685* probably null Het
2700049A03Rik A T 12: 71,164,547 E685V possibly damaging Het
4921501E09Rik C T 17: 33,066,739 S363N probably benign Het
Ablim2 C T 5: 35,802,422 R73C possibly damaging Het
Adad1 G T 3: 37,085,111 L443F probably damaging Het
Amph T A 13: 19,084,208 M70K probably damaging Het
Ankra2 T A 13: 98,273,411 L306H probably damaging Het
Arc A C 15: 74,671,743 D210E probably benign Het
Arhgap10 A G 8: 77,432,738 probably null Het
Atp8b5 T A 4: 43,344,449 N445K probably benign Het
C1qc G T 4: 136,890,435 Q117K probably benign Het
Cadps T A 14: 12,822,449 E97V unknown Het
Capn13 GCA G 17: 73,351,506 probably null Het
Cdk13 A T 13: 17,721,283 W1014R probably damaging Het
Cltb C T 13: 54,599,095 E23K probably damaging Het
Clvs2 A T 10: 33,622,646 I96N probably damaging Het
Cwf19l1 A G 19: 44,114,567 V403A probably damaging Het
Ddr2 A T 1: 169,988,497 L547Q possibly damaging Het
Ebf1 A T 11: 44,972,908 K354* probably null Het
Fam208b A T 13: 3,566,680 probably null Het
Fat4 A G 3: 38,888,317 Q453R probably benign Het
Gas2l3 CACTCGTCATACT CACT 10: 89,430,958 probably benign Het
Gata6 A G 18: 11,054,497 E142G possibly damaging Het
Gm14221 T C 2: 160,574,680 noncoding transcript Het
Gm42791 C A 5: 148,959,437 probably benign Het
Gm6370 G T 5: 146,493,811 V269L probably benign Het
Gphn G A 12: 78,627,210 V526M probably damaging Het
Gpt A T 15: 76,699,285 E206V probably damaging Het
Grm3 G A 5: 9,570,047 A399V probably damaging Het
Helq A T 5: 100,783,159 V575E possibly damaging Het
Herc4 A G 10: 63,315,658 probably null Het
Ifi207 A T 1: 173,729,815 N452K probably damaging Het
Ikbke A G 1: 131,257,111 probably null Het
Kbtbd2 A G 6: 56,779,702 F350L probably benign Het
Kmt2c A G 5: 25,314,557 V2185A probably benign Het
Lgi2 T C 5: 52,538,507 Q362R probably damaging Het
Lrit1 G A 14: 37,061,816 G367E possibly damaging Het
Lrp1 G A 10: 127,610,442 H78Y probably benign Het
Matk A G 10: 81,262,886 probably benign Het
Med21 G A 6: 146,648,192 G24S probably damaging Het
Met G T 6: 17,558,797 L1141F probably damaging Het
Mroh3 A T 1: 136,200,939 probably null Het
Mrpl15 T C 1: 4,774,460 I203V probably benign Het
Naip1 T C 13: 100,423,220 probably null Het
Ndufa9 A C 6: 126,827,542 Y298* probably null Het
Neb T C 2: 52,298,894 E808G probably damaging Het
Nol4l C T 2: 153,411,806 G616S probably benign Het
Olfr1290 T G 2: 111,489,948 D70A probably damaging Het
Olfr1306 A G 2: 111,912,099 V277A probably benign Het
Olfr676 T A 7: 105,035,651 I151N probably damaging Het
Olfr700 T C 7: 106,806,256 M69V probably benign Het
Olfr988 T C 2: 85,353,449 N159S possibly damaging Het
Oprm1 T A 10: 6,838,468 C408S probably benign Het
Paqr3 A G 5: 97,108,194 I107T possibly damaging Het
Pik3ap1 T C 19: 41,327,845 D326G probably benign Het
Plaa G T 4: 94,586,408 D252E probably damaging Het
Plxna2 G A 1: 194,797,732 V1404I probably benign Het
Ppargc1a G A 5: 51,474,222 A355V possibly damaging Het
Primpol A G 8: 46,586,691 S350P probably benign Het
Prlr T C 15: 10,328,797 S453P probably benign Het
Psmd5 T C 2: 34,852,552 probably benign Het
Robo2 A T 16: 73,971,191 V571E probably damaging Het
Sbspon A T 1: 15,859,040 S176T possibly damaging Het
Scyl2 G A 10: 89,640,463 probably benign Het
Sema3e T A 5: 14,230,130 V341E probably damaging Het
Serpinb3b A T 1: 107,154,540 F331L possibly damaging Het
Setd2 A G 9: 110,571,954 H1736R probably benign Het
Sidt2 A T 9: 45,952,029 D180E probably benign Het
Skint9 A T 4: 112,391,011 Y179N probably benign Het
Slc27a5 T C 7: 12,988,633 N638S probably benign Het
Slc6a4 T A 11: 77,013,309 W197R probably damaging Het
Spag17 A T 3: 100,063,333 M1278L probably benign Het
Sptbn1 T A 11: 30,142,353 I471F probably damaging Het
Teddm1a A G 1: 153,892,636 Q282R probably benign Het
Tex35 A G 1: 157,099,725 L160P probably damaging Het
Tfap2c T C 2: 172,551,518 Y118H probably damaging Het
Tpp1 T C 7: 105,746,723 Q533R probably benign Het
Ttc13 C T 8: 124,674,435 D730N probably damaging Het
Ufc1 A G 1: 171,294,802 probably benign Het
Vcpip1 A G 1: 9,747,364 W265R probably damaging Het
Wdr11 C G 7: 129,600,434 probably null Het
Xirp2 A G 2: 67,511,064 I1216M possibly damaging Het
Zswim2 A G 2: 83,916,843 probably null Het
Other mutations in Pex5l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01397:Pex5l APN 3 32952597 missense probably damaging 1.00
IGL01621:Pex5l APN 3 33014961 splice site probably null
IGL01813:Pex5l APN 3 33082055 missense probably benign 0.02
IGL02313:Pex5l APN 3 32992992 missense probably benign 0.22
IGL02508:Pex5l APN 3 32992902 splice site probably benign
IGL02997:Pex5l APN 3 32955842 splice site probably benign
R0195:Pex5l UTSW 3 32992953 missense possibly damaging 0.87
R0674:Pex5l UTSW 3 32952616 missense probably damaging 1.00
R0729:Pex5l UTSW 3 32954536 splice site probably benign
R1500:Pex5l UTSW 3 33014980 missense probably damaging 1.00
R1513:Pex5l UTSW 3 33015013 nonsense probably null
R1695:Pex5l UTSW 3 32954382 missense probably benign 0.28
R1850:Pex5l UTSW 3 32950876 splice site probably null
R2165:Pex5l UTSW 3 32953132 synonymous probably null
R2679:Pex5l UTSW 3 33082052 missense probably benign 0.02
R2880:Pex5l UTSW 3 32993003 critical splice acceptor site probably null
R2881:Pex5l UTSW 3 32993003 critical splice acceptor site probably null
R3766:Pex5l UTSW 3 33007178 missense probably benign 0.01
R3780:Pex5l UTSW 3 32950844 missense probably damaging 1.00
R3934:Pex5l UTSW 3 33007172 missense probably damaging 1.00
R3975:Pex5l UTSW 3 33015015 missense probably damaging 0.99
R4285:Pex5l UTSW 3 33007187 missense probably damaging 1.00
R4825:Pex5l UTSW 3 32992985 missense probably damaging 0.99
R4868:Pex5l UTSW 3 32952490 missense probably damaging 1.00
R5135:Pex5l UTSW 3 32955831 missense probably damaging 1.00
R5217:Pex5l UTSW 3 33007328 splice site probably null
R5223:Pex5l UTSW 3 32958796 missense probably damaging 1.00
R5362:Pex5l UTSW 3 32992916 missense probably damaging 1.00
R5398:Pex5l UTSW 3 32952490 missense probably damaging 1.00
R5829:Pex5l UTSW 3 33005990 missense probably benign 0.00
R6731:Pex5l UTSW 3 32958798 missense probably damaging 1.00
R7180:Pex5l UTSW 3 33024691 splice site probably null
R7452:Pex5l UTSW 3 33004318 missense probably benign 0.02
R7549:Pex5l UTSW 3 33082035 missense not run
R7563:Pex5l UTSW 3 32954476 missense not run
Predicted Primers PCR Primer
(F):5'- GCTTAAAGGCACAGGCTCAAG -3'
(R):5'- TACTCCTCTGAACCACCAGG -3'

Sequencing Primer
(F):5'- GGCTCAAGACTGCCCAGAAAG -3'
(R):5'- ACAGGACCGGCGAGTTG -3'
Posted On2016-03-01