Incidental Mutation 'R4857:Gtf2ird1'
ID374046
Institutional Source Beutler Lab
Gene Symbol Gtf2ird1
Ensembl Gene ENSMUSG00000023079
Gene Namegeneral transcription factor II I repeat domain-containing 1
Synonymsbinding factor for early enhancer, MusTRD1, GTF3, WBSCR11, Tg(Alb1-Myc)166.8Sst, ESTM9, c-myc line 166.8, Alb/c-myc line 166.8, Alb-c-myc line 166.8, Cream1, BEN
MMRRC Submission 042468-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.518) question?
Stock #R4857 (G1)
Quality Score143
Status Validated
Chromosome5
Chromosomal Location134357656-134456716 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 134362544 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 866 (F866L)
Ref Sequence ENSEMBL: ENSMUSP00000098215 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073161] [ENSMUST00000074114] [ENSMUST00000100650] [ENSMUST00000100652] [ENSMUST00000100654] [ENSMUST00000111244] [ENSMUST00000111245] [ENSMUST00000167084] [ENSMUST00000171794] [ENSMUST00000200944] [ENSMUST00000202104] [ENSMUST00000202165] [ENSMUST00000202280] [ENSMUST00000202321] [ENSMUST00000202554] [ENSMUST00000202829]
Predicted Effect probably benign
Transcript: ENSMUST00000073161
AA Change: F893L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000072904
Gene: ENSMUSG00000023079
AA Change: F893L

DomainStartEndE-ValueType
Pfam:GTF2I 128 203 1.5e-29 PFAM
Pfam:GTF2I 351 426 4.9e-33 PFAM
low complexity region 543 558 N/A INTRINSIC
Pfam:GTF2I 565 640 1.1e-34 PFAM
Pfam:GTF2I 690 765 3.1e-34 PFAM
Pfam:GTF2I 814 889 1.7e-34 PFAM
Pfam:GTF2I 917 992 1.7e-34 PFAM
low complexity region 1020 1043 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000074114
SMART Domains Protein: ENSMUSP00000073752
Gene: ENSMUSG00000023079

DomainStartEndE-ValueType
Pfam:GTF2I 128 203 1.4e-29 PFAM
Pfam:GTF2I 351 426 4.5e-33 PFAM
low complexity region 543 558 N/A INTRINSIC
Pfam:GTF2I 565 640 1.1e-34 PFAM
Pfam:GTF2I 690 765 2.8e-34 PFAM
Pfam:GTF2I 814 889 1.6e-34 PFAM
low complexity region 917 940 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000100650
AA Change: F866L

PolyPhen 2 Score 0.963 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000098215
Gene: ENSMUSG00000023079
AA Change: F866L

DomainStartEndE-ValueType
Pfam:GTF2I 128 203 1.5e-29 PFAM
Pfam:GTF2I 351 426 4.9e-33 PFAM
low complexity region 543 558 N/A INTRINSIC
Pfam:GTF2I 565 640 1.2e-34 PFAM
Pfam:GTF2I 690 765 3.1e-34 PFAM
Pfam:GTF2I 787 862 1.8e-34 PFAM
Pfam:GTF2I 890 965 1.8e-34 PFAM
low complexity region 993 1016 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000100652
AA Change: F893L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000098217
Gene: ENSMUSG00000023079
AA Change: F893L

DomainStartEndE-ValueType
Pfam:GTF2I 128 202 5.8e-29 PFAM
Pfam:GTF2I 351 425 6.6e-32 PFAM
low complexity region 543 558 N/A INTRINSIC
Pfam:GTF2I 565 639 2.3e-34 PFAM
Pfam:GTF2I 690 764 3.3e-32 PFAM
Pfam:GTF2I 814 888 3e-33 PFAM
Pfam:GTF2I 917 991 3e-33 PFAM
low complexity region 1020 1043 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000100654
AA Change: F795L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000098219
Gene: ENSMUSG00000023079
AA Change: F795L

DomainStartEndE-ValueType
Pfam:GTF2I 128 203 1.3e-29 PFAM
Pfam:GTF2I 351 426 4.3e-33 PFAM
low complexity region 543 558 N/A INTRINSIC
Pfam:GTF2I 565 640 1e-34 PFAM
Pfam:GTF2I 716 791 1.5e-34 PFAM
Pfam:GTF2I 819 894 1.5e-34 PFAM
low complexity region 922 945 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111244
AA Change: F866L

PolyPhen 2 Score 0.450 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000106875
Gene: ENSMUSG00000023079
AA Change: F866L

DomainStartEndE-ValueType
Pfam:GTF2I 128 202 4.3e-29 PFAM
Pfam:GTF2I 351 425 4.9e-32 PFAM
low complexity region 543 558 N/A INTRINSIC
Pfam:GTF2I 565 639 1.7e-34 PFAM
Pfam:GTF2I 690 764 2.5e-32 PFAM
Pfam:GTF2I 787 861 2.3e-33 PFAM
Pfam:GTF2I 890 964 2.3e-33 PFAM
low complexity region 993 1016 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111245
AA Change: F847L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000106876
Gene: ENSMUSG00000023079
AA Change: F847L

DomainStartEndE-ValueType
Pfam:GTF2I 128 203 1.4e-29 PFAM
Pfam:GTF2I 351 426 4.6e-33 PFAM
low complexity region 543 558 N/A INTRINSIC
Pfam:GTF2I 565 640 1.1e-34 PFAM
Pfam:GTF2I 671 746 2.9e-34 PFAM
Pfam:GTF2I 768 843 1.7e-34 PFAM
Pfam:GTF2I 871 946 1.7e-34 PFAM
low complexity region 974 997 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000167084
SMART Domains Protein: ENSMUSP00000132882
Gene: ENSMUSG00000023079

DomainStartEndE-ValueType
Pfam:GTF2I 128 203 1.3e-29 PFAM
Pfam:GTF2I 351 426 4.3e-33 PFAM
low complexity region 543 558 N/A INTRINSIC
Pfam:GTF2I 565 640 1e-34 PFAM
Pfam:GTF2I 690 765 2.7e-34 PFAM
Pfam:GTF2I 814 889 1.5e-34 PFAM
low complexity region 917 940 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000171794
AA Change: F866L

PolyPhen 2 Score 0.450 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000129392
Gene: ENSMUSG00000023079
AA Change: F866L

DomainStartEndE-ValueType
Pfam:GTF2I 128 203 1.2e-29 PFAM
Pfam:GTF2I 351 426 3.8e-33 PFAM
low complexity region 543 558 N/A INTRINSIC
Pfam:GTF2I 565 640 8.9e-35 PFAM
Pfam:GTF2I 690 765 2.4e-34 PFAM
Pfam:GTF2I 787 862 1.4e-34 PFAM
Pfam:GTF2I 890 965 1.4e-34 PFAM
low complexity region 993 1016 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000200944
SMART Domains Protein: ENSMUSP00000143848
Gene: ENSMUSG00000023079

DomainStartEndE-ValueType
Pfam:GTF2I 128 202 4.9e-29 PFAM
Pfam:GTF2I 351 425 5.6e-32 PFAM
low complexity region 543 558 N/A INTRINSIC
Pfam:GTF2I 565 639 2e-34 PFAM
Pfam:GTF2I 690 764 2.8e-32 PFAM
Pfam:GTF2I 814 888 2.6e-33 PFAM
low complexity region 917 940 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000201495
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201608
Predicted Effect probably benign
Transcript: ENSMUST00000202104
AA Change: F34L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000144203
Gene: ENSMUSG00000023079
AA Change: F34L

DomainStartEndE-ValueType
Pfam:GTF2I 1 29 7.9e-7 PFAM
Pfam:GTF2I 58 132 7.3e-32 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000202165
SMART Domains Protein: ENSMUSP00000144420
Gene: ENSMUSG00000023079

DomainStartEndE-ValueType
low complexity region 13 28 N/A INTRINSIC
Pfam:GTF2I 35 109 7.6e-33 PFAM
Pfam:GTF2I 167 193 4.2e-8 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202268
Predicted Effect probably benign
Transcript: ENSMUST00000202280
AA Change: F866L

PolyPhen 2 Score 0.264 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000143897
Gene: ENSMUSG00000023079
AA Change: F866L

DomainStartEndE-ValueType
Pfam:GTF2I 128 202 2.6e-26 PFAM
Pfam:GTF2I 351 425 2.9e-29 PFAM
low complexity region 543 558 N/A INTRINSIC
Pfam:GTF2I 565 639 1e-31 PFAM
Pfam:GTF2I 690 764 1.5e-29 PFAM
Pfam:GTF2I 787 861 1.3e-30 PFAM
low complexity region 890 913 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000202321
Predicted Effect probably benign
Transcript: ENSMUST00000202554
AA Change: F847L

PolyPhen 2 Score 0.210 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000143809
Gene: ENSMUSG00000023079
AA Change: F847L

DomainStartEndE-ValueType
Pfam:GTF2I 128 202 5.5e-29 PFAM
Pfam:GTF2I 351 425 6.3e-32 PFAM
low complexity region 543 558 N/A INTRINSIC
Pfam:GTF2I 565 639 2.2e-34 PFAM
Pfam:GTF2I 671 745 3.2e-32 PFAM
Pfam:GTF2I 768 842 2.9e-33 PFAM
Pfam:GTF2I 871 945 2.9e-33 PFAM
low complexity region 974 997 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000202829
AA Change: F166L

PolyPhen 2 Score 0.028 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000144604
Gene: ENSMUSG00000023079
AA Change: F166L

DomainStartEndE-ValueType
Pfam:GTF2I 1 44 1.4e-15 PFAM
Pfam:GTF2I 87 161 4.6e-34 PFAM
Pfam:GTF2I 190 264 4.6e-34 PFAM
low complexity region 293 316 N/A INTRINSIC
Meta Mutation Damage Score 0.0356 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.3%
Validation Efficiency 97% (115/119)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains five GTF2I-like repeats and each repeat possesses a potential helix-loop-helix (HLH) motif. It may have the ability to interact with other HLH-proteins and function as a transcription factor or as a positive transcriptional regulator under the control of Retinoblastoma protein. This gene plays a role in craniofacial and cognitive development and mutations have been associated with Williams-Beuren syndrome, a multisystem developmental disorder caused by deletion of multiple genes at 7q11.23. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2010]
PHENOTYPE: Homozygotes for one null allele is embryonic lethal with abnormal yolk sac vasulogenesis, abnormal angiogenesis, and neural tube defect. Other null allele homozygous mice are viable and have behavioral defects and exhibit a mild craniofacial defect withvariable penetrance. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 101 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930548G14Rik C T 15: 46,625,531 noncoding transcript Het
4932415D10Rik T C 10: 82,283,848 T4443A possibly damaging Het
Aasdh A T 5: 76,887,284 F428L probably benign Het
Abca13 A G 11: 9,294,143 N2002S probably benign Het
Acot7 T G 4: 152,237,754 F248V possibly damaging Het
Acsf2 A G 11: 94,569,338 I396T probably benign Het
Agbl1 A G 7: 76,419,835 N372D probably benign Het
Ahctf1 A T 1: 179,799,357 probably benign Het
Akap11 T C 14: 78,498,860 D1830G probably damaging Het
Bcl7b A G 5: 135,173,179 *59W probably null Het
Bdh1 A G 16: 31,447,548 probably null Het
Bin3 A G 14: 70,128,895 N69S probably benign Het
Bsdc1 T C 4: 129,471,892 probably benign Het
Cacna1i T C 15: 80,369,662 V700A probably damaging Het
Calcr T C 6: 3,708,511 N225S probably benign Het
Cdh23 A G 10: 60,391,784 S1173P probably damaging Het
Cftr C T 6: 18,320,975 T1428M possibly damaging Het
Chd1l T C 3: 97,572,659 K591E probably benign Het
Chrd C T 16: 20,738,758 P709L possibly damaging Het
Ckap4 T C 10: 84,533,488 R127G possibly damaging Het
Cnbd2 T C 2: 156,367,565 F476S probably benign Het
Dclk3 T C 9: 111,468,648 V420A probably benign Het
Dnah5 A G 15: 28,345,807 D2431G probably benign Het
Duox1 T A 2: 122,315,731 I10N probably benign Het
Ece2 T A 16: 20,617,806 V126D probably damaging Het
Elfn1 T C 5: 139,973,085 Y615H probably damaging Het
Epha1 T C 6: 42,361,482 D720G probably benign Het
Fras1 A G 5: 96,778,159 I3741V probably benign Het
Gm13088 A T 4: 143,656,588 N20K possibly damaging Het
Gm53 A T 11: 96,251,736 noncoding transcript Het
Grb10 G T 11: 11,951,469 probably benign Het
Grid2ip A G 5: 143,382,629 H568R probably damaging Het
Gsap A T 5: 21,287,799 probably null Het
Gse1 T C 8: 120,572,757 probably benign Het
Gstm1 T C 3: 108,016,408 R94G possibly damaging Het
Haao T A 17: 83,838,580 probably null Het
Hcn4 A T 9: 58,859,570 I805F unknown Het
Hemk1 A T 9: 107,329,448 probably benign Het
Il12rb1 A T 8: 70,810,588 Y33F possibly damaging Het
Il19 T A 1: 130,935,946 I103F probably damaging Het
Itpr1 A G 6: 108,410,867 N1522S probably benign Het
Klhdc8a A G 1: 132,303,105 Y236C probably damaging Het
Klhl3 C T 13: 58,018,806 G404S probably damaging Het
Large2 T C 2: 92,366,634 probably benign Het
Lgi1 C A 19: 38,306,250 A490E probably damaging Het
Lmbr1 A G 5: 29,323,809 L112P probably damaging Het
Lmo7 T A 14: 101,887,348 probably null Het
Lpin1 A C 12: 16,563,630 I479S possibly damaging Het
Lrrc40 T A 3: 158,066,229 probably benign Het
Lrrc9 A G 12: 72,499,692 N1218S possibly damaging Het
Map3k9 A G 12: 81,724,627 V729A probably benign Het
Marf1 A T 16: 14,128,611 Y1215* probably null Het
Moap1 T A 12: 102,742,565 I242L probably benign Het
Mpo A G 11: 87,796,281 K218E probably benign Het
Mpz C T 1: 171,158,810 R98C probably damaging Het
Neb T G 2: 52,201,980 K5024T probably damaging Het
Nlrp4b C T 7: 10,715,298 T109I probably benign Het
Noc3l T A 19: 38,792,800 probably null Het
Nosip G A 7: 45,076,678 V220I probably benign Het
Nyap1 A C 5: 137,735,578 S398A probably damaging Het
Olfr109 A G 17: 37,466,823 M206V possibly damaging Het
Olfr1240 T G 2: 89,439,623 I219L probably damaging Het
Olfr1278 A G 2: 111,293,143 N292D possibly damaging Het
Osbpl7 T C 11: 97,056,669 probably benign Het
Pard3 A T 8: 127,324,054 Y199F probably damaging Het
Pcdha11 G A 18: 37,011,452 V199I probably benign Het
Pcdhga8 A T 18: 37,726,914 N341I probably damaging Het
Pcsk4 A G 10: 80,325,039 S318P probably damaging Het
Phldb1 C A 9: 44,696,092 R1272L probably damaging Het
Phlpp2 A G 8: 109,877,010 T103A probably damaging Het
Pibf1 T A 14: 99,186,501 Y503* probably null Het
Pkn1 A T 8: 83,684,227 probably null Het
Ptprf A G 4: 118,217,197 probably benign Het
Rbm19 C A 5: 120,132,833 probably benign Het
Rcan1 T C 16: 92,465,906 D5G possibly damaging Het
Recql5 A T 11: 115,928,212 L176Q probably damaging Het
Rev3l T A 10: 39,838,459 L2393Q probably damaging Het
Rp1 C A 1: 4,352,316 K180N probably damaging Het
Rp1 T A 1: 4,352,317 K180M probably damaging Het
Sdk1 T C 5: 142,161,776 V1461A probably benign Het
Sdk2 A T 11: 113,821,382 L1653* probably null Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Skint10 A T 4: 112,746,633 V119D possibly damaging Het
Sncaip T C 18: 52,869,225 S273P probably benign Het
Sp1 T G 15: 102,430,974 I449S probably damaging Het
Spats2 T C 15: 99,174,420 L78P probably damaging Het
Spert C T 14: 75,593,038 E8K probably damaging Het
Stambp T A 6: 83,556,366 N305I probably benign Het
Stim2 A T 5: 54,118,546 S688C probably damaging Het
Sytl3 A G 17: 6,736,581 N355S probably damaging Het
Taf4b C T 18: 14,804,578 A236V probably null Het
Tnfaip6 A G 2: 52,051,074 probably null Het
Trpc2 T A 7: 102,083,969 S416T probably benign Het
Ttn T C 2: 76,738,866 T27228A probably damaging Het
Uhrf1bp1l A T 10: 89,779,963 N156I probably damaging Het
Ush2a T A 1: 188,537,720 D1721E probably benign Het
Usp47 T A 7: 112,082,552 H523Q probably damaging Het
Vmn1r8 A T 6: 57,036,353 I130F probably benign Het
Vps13b A G 15: 35,456,654 S749G probably benign Het
Xrcc5 C A 1: 72,326,265 T283K possibly damaging Het
Ydjc A G 16: 17,148,138 probably benign Het
Other mutations in Gtf2ird1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00558:Gtf2ird1 APN 5 134358891 missense probably benign 0.03
IGL02477:Gtf2ird1 APN 5 134379978 missense probably damaging 1.00
IGL02659:Gtf2ird1 APN 5 134377041 missense probably damaging 1.00
IGL02752:Gtf2ird1 APN 5 134358824 makesense probably null
IGL02963:Gtf2ird1 APN 5 134389687 missense probably benign 0.05
IGL03328:Gtf2ird1 APN 5 134389129 critical splice donor site probably null
IGL03379:Gtf2ird1 APN 5 134382538 missense possibly damaging 0.94
R0585:Gtf2ird1 UTSW 5 134376942 missense probably damaging 1.00
R1199:Gtf2ird1 UTSW 5 134411064 missense possibly damaging 0.85
R1388:Gtf2ird1 UTSW 5 134395710 missense probably damaging 1.00
R1470:Gtf2ird1 UTSW 5 134395802 critical splice acceptor site probably null
R1470:Gtf2ird1 UTSW 5 134395802 critical splice acceptor site probably null
R1544:Gtf2ird1 UTSW 5 134358918 missense possibly damaging 0.93
R1652:Gtf2ird1 UTSW 5 134395713 missense probably damaging 1.00
R1792:Gtf2ird1 UTSW 5 134366936 intron probably null
R1852:Gtf2ird1 UTSW 5 134382580 unclassified probably null
R1938:Gtf2ird1 UTSW 5 134415245 missense probably damaging 1.00
R1996:Gtf2ird1 UTSW 5 134376886 splice site probably benign
R2020:Gtf2ird1 UTSW 5 134417093 missense probably damaging 1.00
R2025:Gtf2ird1 UTSW 5 134363934 missense probably damaging 1.00
R2849:Gtf2ird1 UTSW 5 134359007 missense probably damaging 1.00
R2964:Gtf2ird1 UTSW 5 134357684 unclassified probably null
R3421:Gtf2ird1 UTSW 5 134388500 missense probably benign 0.41
R4543:Gtf2ird1 UTSW 5 134363900 critical splice donor site probably null
R4569:Gtf2ird1 UTSW 5 134411003 missense probably damaging 1.00
R4664:Gtf2ird1 UTSW 5 134383902 missense probably damaging 1.00
R4665:Gtf2ird1 UTSW 5 134383902 missense probably damaging 1.00
R4666:Gtf2ird1 UTSW 5 134383902 missense probably damaging 1.00
R4680:Gtf2ird1 UTSW 5 134357881 missense probably damaging 1.00
R4709:Gtf2ird1 UTSW 5 134404734 missense probably benign
R4806:Gtf2ird1 UTSW 5 134383896 missense probably damaging 0.99
R4823:Gtf2ird1 UTSW 5 134395722 missense probably damaging 1.00
R4970:Gtf2ird1 UTSW 5 134402184 missense probably damaging 1.00
R4974:Gtf2ird1 UTSW 5 134357831 nonsense probably null
R4975:Gtf2ird1 UTSW 5 134395627 missense probably damaging 1.00
R5072:Gtf2ird1 UTSW 5 134390933 splice site probably null
R5112:Gtf2ird1 UTSW 5 134402184 missense probably damaging 1.00
R5653:Gtf2ird1 UTSW 5 134410967 missense probably damaging 1.00
R5681:Gtf2ird1 UTSW 5 134363318 missense probably damaging 1.00
R5738:Gtf2ird1 UTSW 5 134383818 missense probably damaging 1.00
R5753:Gtf2ird1 UTSW 5 134410983 missense probably damaging 1.00
R6385:Gtf2ird1 UTSW 5 134404690 missense probably benign 0.19
R6580:Gtf2ird1 UTSW 5 134361039 missense probably damaging 1.00
R6787:Gtf2ird1 UTSW 5 134363912 missense probably damaging 0.99
R6981:Gtf2ird1 UTSW 5 134383922 splice site probably benign
R7208:Gtf2ird1 UTSW 5 134411094 missense probably benign 0.35
R7271:Gtf2ird1 UTSW 5 134404904 missense probably benign 0.01
X0026:Gtf2ird1 UTSW 5 134376102 splice site probably null
Predicted Primers PCR Primer
(F):5'- ACGTACAGCTTAGCTCACTC -3'
(R):5'- TCCTGAGTCAGAAGATCAACTCC -3'

Sequencing Primer
(F):5'- CAGCTTAGCTCACTCTGTTTTAAAGG -3'
(R):5'- GGAAGGATGTTTCCCATGACCTATC -3'
Posted On2016-03-01