Incidental Mutation 'R4857:Pcsk4'
ID374073
Institutional Source Beutler Lab
Gene Symbol Pcsk4
Ensembl Gene ENSMUSG00000020131
Gene Nameproprotein convertase subtilisin/kexin type 4
SynonymsPC4, SPC5
MMRRC Submission 042468-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4857 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location80321283-80329498 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 80325039 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 318 (S318P)
Ref Sequence ENSEMBL: ENSMUSP00000020340 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020340] [ENSMUST00000020341] [ENSMUST00000105354] [ENSMUST00000105355] [ENSMUST00000105357] [ENSMUST00000105358] [ENSMUST00000128653] [ENSMUST00000135071]
Predicted Effect probably damaging
Transcript: ENSMUST00000020340
AA Change: S318P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000020340
Gene: ENSMUSG00000020131
AA Change: S318P

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:S8_pro-domain 34 110 1.2e-24 PFAM
Pfam:Peptidase_S8 146 429 3.1e-50 PFAM
Pfam:P_proprotein 488 574 5e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000020341
SMART Domains Protein: ENSMUSP00000020341
Gene: ENSMUSG00000020133

DomainStartEndE-ValueType
Pfam:UPF0449 6 103 7.5e-40 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000105354
SMART Domains Protein: ENSMUSP00000100991
Gene: ENSMUSG00000035504

DomainStartEndE-ValueType
Pfam:TB2_DP1_HVA22 50 144 5e-36 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000105355
SMART Domains Protein: ENSMUSP00000100992
Gene: ENSMUSG00000035504

DomainStartEndE-ValueType
Pfam:TB2_DP1_HVA22 50 144 3.4e-36 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000105357
SMART Domains Protein: ENSMUSP00000100994
Gene: ENSMUSG00000035504

DomainStartEndE-ValueType
low complexity region 22 61 N/A INTRINSIC
low complexity region 108 129 N/A INTRINSIC
low complexity region 297 319 N/A INTRINSIC
low complexity region 340 352 N/A INTRINSIC
low complexity region 411 428 N/A INTRINSIC
SCOP:d1gkub1 434 465 1e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000105358
SMART Domains Protein: ENSMUSP00000100995
Gene: ENSMUSG00000035504

DomainStartEndE-ValueType
low complexity region 22 61 N/A INTRINSIC
low complexity region 108 129 N/A INTRINSIC
low complexity region 324 346 N/A INTRINSIC
low complexity region 367 379 N/A INTRINSIC
low complexity region 438 455 N/A INTRINSIC
SCOP:d1gkub1 461 492 8e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000128653
SMART Domains Protein: ENSMUSP00000137809
Gene: ENSMUSG00000020131

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
SCOP:d1kn6a_ 31 102 8e-29 SMART
Pfam:Peptidase_S8 150 242 6.4e-18 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130521
Predicted Effect probably benign
Transcript: ENSMUST00000135071
SMART Domains Protein: ENSMUSP00000137719
Gene: ENSMUSG00000020131

DomainStartEndE-ValueType
SCOP:d1kn6a_ 14 85 3e-27 SMART
Pfam:Peptidase_S8 133 187 1.7e-7 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137177
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147132
Meta Mutation Damage Score 0.368 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.3%
Validation Efficiency 97% (115/119)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the subtilisin-like proprotein convertase family, which includes proteases that process protein and peptide precursors trafficking through regulated or constitutive branches of the secretory pathway. The encoded protein undergoes an initial autocatalytic processing event in the ER to generate a heterodimer which exits the ER and sorts to subcellular compartments where a second autocatalytic even takes place and the catalytic activity is acquired. This gene encodes one of the seven basic amino acid-specific members which cleave their substrates at single or paired basic residues. The protease is expressed only in the testis, placenta, and ovary. It plays a critical role in fertilization, fetoplacental growth, and embryonic development and processes multiple prohormones including pro-pituitary adenylate cyclase-activating protein and pro-insulin-like growth factor II. [provided by RefSeq, Jan 2014]
PHENOTYPE: Inactivation of this locus results in significantly reduced male fertility, putatively due to impaired fertilization. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 101 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930548G14Rik C T 15: 46,625,531 noncoding transcript Het
4932415D10Rik T C 10: 82,283,848 T4443A possibly damaging Het
Aasdh A T 5: 76,887,284 F428L probably benign Het
Abca13 A G 11: 9,294,143 N2002S probably benign Het
Acot7 T G 4: 152,237,754 F248V possibly damaging Het
Acsf2 A G 11: 94,569,338 I396T probably benign Het
Agbl1 A G 7: 76,419,835 N372D probably benign Het
Ahctf1 A T 1: 179,799,357 probably benign Het
Akap11 T C 14: 78,498,860 D1830G probably damaging Het
Bcl7b A G 5: 135,173,179 *59W probably null Het
Bdh1 A G 16: 31,447,548 probably null Het
Bin3 A G 14: 70,128,895 N69S probably benign Het
Bsdc1 T C 4: 129,471,892 probably benign Het
Cacna1i T C 15: 80,369,662 V700A probably damaging Het
Calcr T C 6: 3,708,511 N225S probably benign Het
Cdh23 A G 10: 60,391,784 S1173P probably damaging Het
Cftr C T 6: 18,320,975 T1428M possibly damaging Het
Chd1l T C 3: 97,572,659 K591E probably benign Het
Chrd C T 16: 20,738,758 P709L possibly damaging Het
Ckap4 T C 10: 84,533,488 R127G possibly damaging Het
Cnbd2 T C 2: 156,367,565 F476S probably benign Het
Dclk3 T C 9: 111,468,648 V420A probably benign Het
Dnah5 A G 15: 28,345,807 D2431G probably benign Het
Duox1 T A 2: 122,315,731 I10N probably benign Het
Ece2 T A 16: 20,617,806 V126D probably damaging Het
Elfn1 T C 5: 139,973,085 Y615H probably damaging Het
Epha1 T C 6: 42,361,482 D720G probably benign Het
Fras1 A G 5: 96,778,159 I3741V probably benign Het
Gm13088 A T 4: 143,656,588 N20K possibly damaging Het
Gm53 A T 11: 96,251,736 noncoding transcript Het
Grb10 G T 11: 11,951,469 probably benign Het
Grid2ip A G 5: 143,382,629 H568R probably damaging Het
Gsap A T 5: 21,287,799 probably null Het
Gse1 T C 8: 120,572,757 probably benign Het
Gstm1 T C 3: 108,016,408 R94G possibly damaging Het
Gtf2ird1 A G 5: 134,362,544 F866L probably damaging Het
Haao T A 17: 83,838,580 probably null Het
Hcn4 A T 9: 58,859,570 I805F unknown Het
Hemk1 A T 9: 107,329,448 probably benign Het
Il12rb1 A T 8: 70,810,588 Y33F possibly damaging Het
Il19 T A 1: 130,935,946 I103F probably damaging Het
Itpr1 A G 6: 108,410,867 N1522S probably benign Het
Klhdc8a A G 1: 132,303,105 Y236C probably damaging Het
Klhl3 C T 13: 58,018,806 G404S probably damaging Het
Large2 T C 2: 92,366,634 probably benign Het
Lgi1 C A 19: 38,306,250 A490E probably damaging Het
Lmbr1 A G 5: 29,323,809 L112P probably damaging Het
Lmo7 T A 14: 101,887,348 probably null Het
Lpin1 A C 12: 16,563,630 I479S possibly damaging Het
Lrrc40 T A 3: 158,066,229 probably benign Het
Lrrc9 A G 12: 72,499,692 N1218S possibly damaging Het
Map3k9 A G 12: 81,724,627 V729A probably benign Het
Marf1 A T 16: 14,128,611 Y1215* probably null Het
Moap1 T A 12: 102,742,565 I242L probably benign Het
Mpo A G 11: 87,796,281 K218E probably benign Het
Mpz C T 1: 171,158,810 R98C probably damaging Het
Neb T G 2: 52,201,980 K5024T probably damaging Het
Nlrp4b C T 7: 10,715,298 T109I probably benign Het
Noc3l T A 19: 38,792,800 probably null Het
Nosip G A 7: 45,076,678 V220I probably benign Het
Nyap1 A C 5: 137,735,578 S398A probably damaging Het
Olfr109 A G 17: 37,466,823 M206V possibly damaging Het
Olfr1240 T G 2: 89,439,623 I219L probably damaging Het
Olfr1278 A G 2: 111,293,143 N292D possibly damaging Het
Osbpl7 T C 11: 97,056,669 probably benign Het
Pard3 A T 8: 127,324,054 Y199F probably damaging Het
Pcdha11 G A 18: 37,011,452 V199I probably benign Het
Pcdhga8 A T 18: 37,726,914 N341I probably damaging Het
Phldb1 C A 9: 44,696,092 R1272L probably damaging Het
Phlpp2 A G 8: 109,877,010 T103A probably damaging Het
Pibf1 T A 14: 99,186,501 Y503* probably null Het
Pkn1 A T 8: 83,684,227 probably null Het
Ptprf A G 4: 118,217,197 probably benign Het
Rbm19 C A 5: 120,132,833 probably benign Het
Rcan1 T C 16: 92,465,906 D5G possibly damaging Het
Recql5 A T 11: 115,928,212 L176Q probably damaging Het
Rev3l T A 10: 39,838,459 L2393Q probably damaging Het
Rp1 C A 1: 4,352,316 K180N probably damaging Het
Rp1 T A 1: 4,352,317 K180M probably damaging Het
Sdk1 T C 5: 142,161,776 V1461A probably benign Het
Sdk2 A T 11: 113,821,382 L1653* probably null Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Skint10 A T 4: 112,746,633 V119D possibly damaging Het
Sncaip T C 18: 52,869,225 S273P probably benign Het
Sp1 T G 15: 102,430,974 I449S probably damaging Het
Spats2 T C 15: 99,174,420 L78P probably damaging Het
Spert C T 14: 75,593,038 E8K probably damaging Het
Stambp T A 6: 83,556,366 N305I probably benign Het
Stim2 A T 5: 54,118,546 S688C probably damaging Het
Sytl3 A G 17: 6,736,581 N355S probably damaging Het
Taf4b C T 18: 14,804,578 A236V probably null Het
Tnfaip6 A G 2: 52,051,074 probably null Het
Trpc2 T A 7: 102,083,969 S416T probably benign Het
Ttn T C 2: 76,738,866 T27228A probably damaging Het
Uhrf1bp1l A T 10: 89,779,963 N156I probably damaging Het
Ush2a T A 1: 188,537,720 D1721E probably benign Het
Usp47 T A 7: 112,082,552 H523Q probably damaging Het
Vmn1r8 A T 6: 57,036,353 I130F probably benign Het
Vps13b A G 15: 35,456,654 S749G probably benign Het
Xrcc5 C A 1: 72,326,265 T283K possibly damaging Het
Ydjc A G 16: 17,148,138 probably benign Het
Other mutations in Pcsk4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00161:Pcsk4 APN 10 80322823 missense probably damaging 1.00
IGL02818:Pcsk4 APN 10 80322792 missense probably damaging 0.98
IGL03115:Pcsk4 APN 10 80329049 missense probably damaging 1.00
IGL03354:Pcsk4 APN 10 80326059 missense probably damaging 0.99
R0538:Pcsk4 UTSW 10 80325334 missense probably damaging 1.00
R0760:Pcsk4 UTSW 10 80325941 unclassified probably benign
R1462:Pcsk4 UTSW 10 80325981 missense probably damaging 1.00
R1462:Pcsk4 UTSW 10 80325981 missense probably damaging 1.00
R1554:Pcsk4 UTSW 10 80321951 missense probably benign 0.01
R1728:Pcsk4 UTSW 10 80323570 missense probably damaging 0.99
R1784:Pcsk4 UTSW 10 80323570 missense probably damaging 0.99
R1886:Pcsk4 UTSW 10 80328960 missense probably benign 0.32
R1981:Pcsk4 UTSW 10 80325779 missense probably damaging 1.00
R2090:Pcsk4 UTSW 10 80325821 missense probably benign 0.02
R2125:Pcsk4 UTSW 10 80323879 missense probably benign 0.32
R2283:Pcsk4 UTSW 10 80322750 missense probably damaging 1.00
R4183:Pcsk4 UTSW 10 80325011 missense probably benign 0.12
R4283:Pcsk4 UTSW 10 80329453 unclassified probably benign
R4798:Pcsk4 UTSW 10 80323104 missense probably damaging 1.00
R4990:Pcsk4 UTSW 10 80325381 missense possibly damaging 0.74
R4991:Pcsk4 UTSW 10 80325381 missense possibly damaging 0.74
R5020:Pcsk4 UTSW 10 80326035 missense probably benign 0.00
R5123:Pcsk4 UTSW 10 80322145 missense probably null 0.56
R5354:Pcsk4 UTSW 10 80323689 missense probably damaging 0.98
R6077:Pcsk4 UTSW 10 80326239 missense probably damaging 0.99
R6102:Pcsk4 UTSW 10 80325817 nonsense probably null
R6250:Pcsk4 UTSW 10 80325592 missense probably benign 0.04
R6378:Pcsk4 UTSW 10 80328975 missense probably benign 0.34
R6729:Pcsk4 UTSW 10 80325101 missense probably damaging 0.99
R7308:Pcsk4 UTSW 10 80323173 missense probably benign 0.41
Predicted Primers PCR Primer
(F):5'- TCTTCAGAGAGCCTCCATGTG -3'
(R):5'- TAACCAAGGTGACCAGGAAC -3'

Sequencing Primer
(F):5'- TGGCACAGATCTTGCCCGAG -3'
(R):5'- AGGAACCACACCCTGGG -3'
Posted On2016-03-01