Incidental Mutation 'R4857:Lrrc9'
ID374087
Institutional Source Beutler Lab
Gene Symbol Lrrc9
Ensembl Gene ENSMUSG00000021090
Gene Nameleucine rich repeat containing 9
Synonyms4930432K16Rik, 4921529O18Rik
MMRRC Submission 042468-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.232) question?
Stock #R4857 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location72441866-72530750 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 72499692 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 1218 (N1218S)
Ref Sequence ENSEMBL: ENSMUSP00000152125 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000161284] [ENSMUST00000162159] [ENSMUST00000220791] [ENSMUST00000221360]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161195
Predicted Effect probably benign
Transcript: ENSMUST00000161284
SMART Domains Protein: ENSMUSP00000124602
Gene: ENSMUSG00000021090

DomainStartEndE-ValueType
Pfam:LRR_4 77 118 2.8e-11 PFAM
LRR 119 140 8.49e1 SMART
LRR 141 164 2.27e1 SMART
LRR 165 187 2.09e2 SMART
LRRcap 210 228 6.12e1 SMART
low complexity region 373 384 N/A INTRINSIC
low complexity region 424 436 N/A INTRINSIC
LRR 706 727 1.41e2 SMART
LRR 728 749 6.78e1 SMART
LRR 750 773 7.17e1 SMART
LRRcap 793 811 2.26e2 SMART
LRR 943 966 2.67e-1 SMART
LRR 967 992 1.22e1 SMART
LRRcap 1031 1049 4.37e0 SMART
low complexity region 1109 1120 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000162159
AA Change: N1217S

PolyPhen 2 Score 0.602 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000124394
Gene: ENSMUSG00000021090
AA Change: N1217S

DomainStartEndE-ValueType
LRR 53 74 5.39e2 SMART
LRR 75 96 1.14e2 SMART
LRR 97 118 7.9e-4 SMART
LRR 119 140 2.75e-3 SMART
LRR 141 164 2.27e1 SMART
LRR 164 185 1.87e1 SMART
LRRcap 210 228 6.12e1 SMART
low complexity region 373 384 N/A INTRINSIC
low complexity region 424 436 N/A INTRINSIC
LRR 705 726 1.41e2 SMART
LRR 727 748 6.78e1 SMART
LRR 749 771 1.37e1 SMART
LRRcap 792 810 2.26e2 SMART
LRR 898 919 2.62e1 SMART
LRR 920 941 5.17e1 SMART
LRR 942 965 2.67e-1 SMART
LRR 966 991 1.22e1 SMART
LRR 1013 1032 4.42e2 SMART
LRRcap 1030 1048 4.37e0 SMART
low complexity region 1108 1119 N/A INTRINSIC
LRR 1128 1150 2.4e1 SMART
LRR 1191 1209 5.7e2 SMART
LRR 1215 1236 1.03e-2 SMART
LRR 1237 1260 8.48e0 SMART
LRR 1283 1304 2.67e-1 SMART
Blast:LRR 1308 1333 4e-6 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000220791
AA Change: N131S

PolyPhen 2 Score 0.867 (Sensitivity: 0.83; Specificity: 0.93)
Predicted Effect possibly damaging
Transcript: ENSMUST00000221360
AA Change: N1218S

PolyPhen 2 Score 0.942 (Sensitivity: 0.80; Specificity: 0.94)
Meta Mutation Damage Score 0.096 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.3%
Validation Efficiency 97% (115/119)
Allele List at MGI
Other mutations in this stock
Total: 101 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930548G14Rik C T 15: 46,625,531 noncoding transcript Het
4932415D10Rik T C 10: 82,283,848 T4443A possibly damaging Het
Aasdh A T 5: 76,887,284 F428L probably benign Het
Abca13 A G 11: 9,294,143 N2002S probably benign Het
Acot7 T G 4: 152,237,754 F248V possibly damaging Het
Acsf2 A G 11: 94,569,338 I396T probably benign Het
Agbl1 A G 7: 76,419,835 N372D probably benign Het
Ahctf1 A T 1: 179,799,357 probably benign Het
Akap11 T C 14: 78,498,860 D1830G probably damaging Het
Bcl7b A G 5: 135,173,179 *59W probably null Het
Bdh1 A G 16: 31,447,548 probably null Het
Bin3 A G 14: 70,128,895 N69S probably benign Het
Bsdc1 T C 4: 129,471,892 probably benign Het
Cacna1i T C 15: 80,369,662 V700A probably damaging Het
Calcr T C 6: 3,708,511 N225S probably benign Het
Cdh23 A G 10: 60,391,784 S1173P probably damaging Het
Cftr C T 6: 18,320,975 T1428M possibly damaging Het
Chd1l T C 3: 97,572,659 K591E probably benign Het
Chrd C T 16: 20,738,758 P709L possibly damaging Het
Ckap4 T C 10: 84,533,488 R127G possibly damaging Het
Cnbd2 T C 2: 156,367,565 F476S probably benign Het
Dclk3 T C 9: 111,468,648 V420A probably benign Het
Dnah5 A G 15: 28,345,807 D2431G probably benign Het
Duox1 T A 2: 122,315,731 I10N probably benign Het
Ece2 T A 16: 20,617,806 V126D probably damaging Het
Elfn1 T C 5: 139,973,085 Y615H probably damaging Het
Epha1 T C 6: 42,361,482 D720G probably benign Het
Fras1 A G 5: 96,778,159 I3741V probably benign Het
Gm13088 A T 4: 143,656,588 N20K possibly damaging Het
Gm53 A T 11: 96,251,736 noncoding transcript Het
Grb10 G T 11: 11,951,469 probably benign Het
Grid2ip A G 5: 143,382,629 H568R probably damaging Het
Gsap A T 5: 21,287,799 probably null Het
Gse1 T C 8: 120,572,757 probably benign Het
Gstm1 T C 3: 108,016,408 R94G possibly damaging Het
Gtf2ird1 A G 5: 134,362,544 F866L probably damaging Het
Haao T A 17: 83,838,580 probably null Het
Hcn4 A T 9: 58,859,570 I805F unknown Het
Hemk1 A T 9: 107,329,448 probably benign Het
Il12rb1 A T 8: 70,810,588 Y33F possibly damaging Het
Il19 T A 1: 130,935,946 I103F probably damaging Het
Itpr1 A G 6: 108,410,867 N1522S probably benign Het
Klhdc8a A G 1: 132,303,105 Y236C probably damaging Het
Klhl3 C T 13: 58,018,806 G404S probably damaging Het
Large2 T C 2: 92,366,634 probably benign Het
Lgi1 C A 19: 38,306,250 A490E probably damaging Het
Lmbr1 A G 5: 29,323,809 L112P probably damaging Het
Lmo7 T A 14: 101,887,348 probably null Het
Lpin1 A C 12: 16,563,630 I479S possibly damaging Het
Lrrc40 T A 3: 158,066,229 probably benign Het
Map3k9 A G 12: 81,724,627 V729A probably benign Het
Marf1 A T 16: 14,128,611 Y1215* probably null Het
Moap1 T A 12: 102,742,565 I242L probably benign Het
Mpo A G 11: 87,796,281 K218E probably benign Het
Mpz C T 1: 171,158,810 R98C probably damaging Het
Neb T G 2: 52,201,980 K5024T probably damaging Het
Nlrp4b C T 7: 10,715,298 T109I probably benign Het
Noc3l T A 19: 38,792,800 probably null Het
Nosip G A 7: 45,076,678 V220I probably benign Het
Nyap1 A C 5: 137,735,578 S398A probably damaging Het
Olfr109 A G 17: 37,466,823 M206V possibly damaging Het
Olfr1240 T G 2: 89,439,623 I219L probably damaging Het
Olfr1278 A G 2: 111,293,143 N292D possibly damaging Het
Osbpl7 T C 11: 97,056,669 probably benign Het
Pard3 A T 8: 127,324,054 Y199F probably damaging Het
Pcdha11 G A 18: 37,011,452 V199I probably benign Het
Pcdhga8 A T 18: 37,726,914 N341I probably damaging Het
Pcsk4 A G 10: 80,325,039 S318P probably damaging Het
Phldb1 C A 9: 44,696,092 R1272L probably damaging Het
Phlpp2 A G 8: 109,877,010 T103A probably damaging Het
Pibf1 T A 14: 99,186,501 Y503* probably null Het
Pkn1 A T 8: 83,684,227 probably null Het
Ptprf A G 4: 118,217,197 probably benign Het
Rbm19 C A 5: 120,132,833 probably benign Het
Rcan1 T C 16: 92,465,906 D5G possibly damaging Het
Recql5 A T 11: 115,928,212 L176Q probably damaging Het
Rev3l T A 10: 39,838,459 L2393Q probably damaging Het
Rp1 C A 1: 4,352,316 K180N probably damaging Het
Rp1 T A 1: 4,352,317 K180M probably damaging Het
Sdk1 T C 5: 142,161,776 V1461A probably benign Het
Sdk2 A T 11: 113,821,382 L1653* probably null Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Skint10 A T 4: 112,746,633 V119D possibly damaging Het
Sncaip T C 18: 52,869,225 S273P probably benign Het
Sp1 T G 15: 102,430,974 I449S probably damaging Het
Spats2 T C 15: 99,174,420 L78P probably damaging Het
Spert C T 14: 75,593,038 E8K probably damaging Het
Stambp T A 6: 83,556,366 N305I probably benign Het
Stim2 A T 5: 54,118,546 S688C probably damaging Het
Sytl3 A G 17: 6,736,581 N355S probably damaging Het
Taf4b C T 18: 14,804,578 A236V probably null Het
Tnfaip6 A G 2: 52,051,074 probably null Het
Trpc2 T A 7: 102,083,969 S416T probably benign Het
Ttn T C 2: 76,738,866 T27228A probably damaging Het
Uhrf1bp1l A T 10: 89,779,963 N156I probably damaging Het
Ush2a T A 1: 188,537,720 D1721E probably benign Het
Usp47 T A 7: 112,082,552 H523Q probably damaging Het
Vmn1r8 A T 6: 57,036,353 I130F probably benign Het
Vps13b A G 15: 35,456,654 S749G probably benign Het
Xrcc5 C A 1: 72,326,265 T283K possibly damaging Het
Ydjc A G 16: 17,148,138 probably benign Het
Other mutations in Lrrc9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00092:Lrrc9 APN 12 72486243 missense possibly damaging 0.63
IGL00843:Lrrc9 APN 12 72463417 missense possibly damaging 0.78
IGL01923:Lrrc9 APN 12 72510412 missense possibly damaging 0.93
IGL02027:Lrrc9 APN 12 72470334 splice site probably benign
IGL02271:Lrrc9 APN 12 72510381 missense probably benign 0.06
IGL02398:Lrrc9 APN 12 72466903 missense probably benign
IGL02795:Lrrc9 APN 12 72478768 missense probably damaging 1.00
IGL02931:Lrrc9 APN 12 72454149 missense probably damaging 1.00
IGL03257:Lrrc9 APN 12 72449768 missense probably benign
IGL02799:Lrrc9 UTSW 12 72506404 missense probably damaging 1.00
R0172:Lrrc9 UTSW 12 72463486 missense possibly damaging 0.50
R0315:Lrrc9 UTSW 12 72456028 missense probably damaging 0.96
R0492:Lrrc9 UTSW 12 72478763 missense possibly damaging 0.47
R0617:Lrrc9 UTSW 12 72483014 missense probably damaging 1.00
R0639:Lrrc9 UTSW 12 72486288 missense probably damaging 1.00
R0987:Lrrc9 UTSW 12 72510382 missense probably benign 0.00
R1325:Lrrc9 UTSW 12 72497104 missense probably damaging 0.99
R1465:Lrrc9 UTSW 12 72500759 missense probably benign 0.05
R1465:Lrrc9 UTSW 12 72500759 missense probably benign 0.05
R1479:Lrrc9 UTSW 12 72460825 nonsense probably null
R1564:Lrrc9 UTSW 12 72487053 missense probably damaging 1.00
R1626:Lrrc9 UTSW 12 72495661 unclassified probably null
R1632:Lrrc9 UTSW 12 72460020 splice site probably null
R1715:Lrrc9 UTSW 12 72477299 missense probably damaging 1.00
R1743:Lrrc9 UTSW 12 72456117 missense probably damaging 1.00
R1779:Lrrc9 UTSW 12 72455998 nonsense probably null
R1866:Lrrc9 UTSW 12 72497138 missense probably damaging 0.97
R1878:Lrrc9 UTSW 12 72476164 critical splice donor site probably null
R1990:Lrrc9 UTSW 12 72497861 missense probably damaging 0.99
R2361:Lrrc9 UTSW 12 72463470 missense possibly damaging 0.52
R3752:Lrrc9 UTSW 12 72460806 nonsense probably null
R3833:Lrrc9 UTSW 12 72482991 missense probably damaging 1.00
R4134:Lrrc9 UTSW 12 72466966 missense probably benign 0.00
R4651:Lrrc9 UTSW 12 72477386 missense probably damaging 1.00
R4652:Lrrc9 UTSW 12 72477386 missense probably damaging 1.00
R4659:Lrrc9 UTSW 12 72470264 missense probably damaging 1.00
R4831:Lrrc9 UTSW 12 72499679 missense probably damaging 1.00
R5017:Lrrc9 UTSW 12 72506325 missense possibly damaging 0.86
R5163:Lrrc9 UTSW 12 72449389 missense probably damaging 1.00
R5279:Lrrc9 UTSW 12 72495594 missense possibly damaging 0.80
R5434:Lrrc9 UTSW 12 72454088 missense probably damaging 0.98
R5783:Lrrc9 UTSW 12 72456053 missense possibly damaging 0.62
R6021:Lrrc9 UTSW 12 72469231 missense probably damaging 0.97
R6214:Lrrc9 UTSW 12 72459853 missense probably damaging 1.00
R6255:Lrrc9 UTSW 12 72487023 missense probably benign 0.33
R6538:Lrrc9 UTSW 12 72500929 missense probably benign 0.08
R6563:Lrrc9 UTSW 12 72486395 splice site probably null
R6672:Lrrc9 UTSW 12 72473936 missense possibly damaging 0.88
R6919:Lrrc9 UTSW 12 72506393 missense probably benign 0.01
R6929:Lrrc9 UTSW 12 72450772 missense probably benign 0.41
R7092:Lrrc9 UTSW 12 72463464 missense possibly damaging 0.81
R7150:Lrrc9 UTSW 12 72466952 missense probably benign 0.00
X0025:Lrrc9 UTSW 12 72497060 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATACCTCTGACTGCCTTTTATGATA -3'
(R):5'- AGGGACTGACTTATGGGGAC -3'

Sequencing Primer
(F):5'- CTGACTGCCTTTTATGATAAAATTGC -3'
(R):5'- CAAGGGAGATAGAGAATACACACAAC -3'
Posted On2016-03-01