Incidental Mutation 'R4857:Dnah5'
ID374096
Institutional Source Beutler Lab
Gene Symbol Dnah5
Ensembl Gene ENSMUSG00000022262
Gene Namedynein, axonemal, heavy chain 5
Synonymsb2b1565Clo, b2b1134Clo, Mdnah5, b2b1537Clo, b2b1154Clo, Dnahc5
MMRRC Submission 042468-MU
Accession Numbers

NCBI RefSeq: NM_133365.3; MGI: 107718

Is this an essential gene? Probably essential (E-score: 0.806) question?
Stock #R4857 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location28203752-28472052 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 28345807 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 2431 (D2431G)
Ref Sequence ENSEMBL: ENSMUSP00000069751 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067048]
Predicted Effect probably benign
Transcript: ENSMUST00000067048
AA Change: D2431G

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000069751
Gene: ENSMUSG00000022262
AA Change: D2431G

DomainStartEndE-ValueType
Pfam:DHC_N1 247 802 2.3e-163 PFAM
low complexity region 1077 1088 N/A INTRINSIC
low complexity region 1113 1128 N/A INTRINSIC
Pfam:DHC_N2 1399 1807 2.3e-134 PFAM
AAA 1972 2108 2e-3 SMART
AAA 2251 2424 4.3e-3 SMART
AAA 2579 2777 2.2e-3 SMART
low complexity region 2874 2889 N/A INTRINSIC
Pfam:AAA_8 2914 3186 3.2e-70 PFAM
Pfam:MT 3198 3546 1e-44 PFAM
Pfam:AAA_9 3567 3792 1.4e-86 PFAM
low complexity region 3889 3899 N/A INTRINSIC
Pfam:Dynein_heavy 3930 4618 4.4e-246 PFAM
Meta Mutation Damage Score 0.242 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.3%
Validation Efficiency 97% (115/119)
MGI Phenotype Strain: 2180081
Lethality: D14-D21
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a dynein protein, which is part of a microtubule-associated motor protein complex consisting of heavy, light, and intermediate chains. This protein is an axonemal heavy chain dynein. It functions as a force-generating protein with ATPase activity, whereby the release of ADP is thought to produce the force-producing power stroke. Mutations in this gene cause primary ciliary dyskinesia type 3, as well as Kartagener syndrome, which are both diseases due to ciliary defects. [provided by RefSeq, Oct 2009]
PHENOTYPE: Mice homozygous for a disruption in this gene display postnatal lethality, hydrocephalus, respiratory infections, situs inversus and ciliary immotility. [provided by MGI curators]
Allele List at MGI

All alleles(11) : Targeted(2) Gene trapped(1) Transgenic(1) Chemically induced(7)

Other mutations in this stock
Total: 101 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930548G14Rik C T 15: 46,625,531 noncoding transcript Het
4932415D10Rik T C 10: 82,283,848 T4443A possibly damaging Het
Aasdh A T 5: 76,887,284 F428L probably benign Het
Abca13 A G 11: 9,294,143 N2002S probably benign Het
Acot7 T G 4: 152,237,754 F248V possibly damaging Het
Acsf2 A G 11: 94,569,338 I396T probably benign Het
Agbl1 A G 7: 76,419,835 N372D probably benign Het
Ahctf1 A T 1: 179,799,357 probably benign Het
Akap11 T C 14: 78,498,860 D1830G probably damaging Het
Bcl7b A G 5: 135,173,179 *59W probably null Het
Bdh1 A G 16: 31,447,548 probably null Het
Bin3 A G 14: 70,128,895 N69S probably benign Het
Bsdc1 T C 4: 129,471,892 probably benign Het
Cacna1i T C 15: 80,369,662 V700A probably damaging Het
Calcr T C 6: 3,708,511 N225S probably benign Het
Cdh23 A G 10: 60,391,784 S1173P probably damaging Het
Cftr C T 6: 18,320,975 T1428M possibly damaging Het
Chd1l T C 3: 97,572,659 K591E probably benign Het
Chrd C T 16: 20,738,758 P709L possibly damaging Het
Ckap4 T C 10: 84,533,488 R127G possibly damaging Het
Cnbd2 T C 2: 156,367,565 F476S probably benign Het
Dclk3 T C 9: 111,468,648 V420A probably benign Het
Duox1 T A 2: 122,315,731 I10N probably benign Het
Ece2 T A 16: 20,617,806 V126D probably damaging Het
Elfn1 T C 5: 139,973,085 Y615H probably damaging Het
Epha1 T C 6: 42,361,482 D720G probably benign Het
Fras1 A G 5: 96,778,159 I3741V probably benign Het
Gm13088 A T 4: 143,656,588 N20K possibly damaging Het
Gm53 A T 11: 96,251,736 noncoding transcript Het
Grb10 G T 11: 11,951,469 probably benign Het
Grid2ip A G 5: 143,382,629 H568R probably damaging Het
Gsap A T 5: 21,287,799 probably null Het
Gse1 T C 8: 120,572,757 probably benign Het
Gstm1 T C 3: 108,016,408 R94G possibly damaging Het
Gtf2ird1 A G 5: 134,362,544 F866L probably damaging Het
Haao T A 17: 83,838,580 probably null Het
Hcn4 A T 9: 58,859,570 I805F unknown Het
Hemk1 A T 9: 107,329,448 probably benign Het
Il12rb1 A T 8: 70,810,588 Y33F possibly damaging Het
Il19 T A 1: 130,935,946 I103F probably damaging Het
Itpr1 A G 6: 108,410,867 N1522S probably benign Het
Klhdc8a A G 1: 132,303,105 Y236C probably damaging Het
Klhl3 C T 13: 58,018,806 G404S probably damaging Het
Large2 T C 2: 92,366,634 probably benign Het
Lgi1 C A 19: 38,306,250 A490E probably damaging Het
Lmbr1 A G 5: 29,323,809 L112P probably damaging Het
Lmo7 T A 14: 101,887,348 probably null Het
Lpin1 A C 12: 16,563,630 I479S possibly damaging Het
Lrrc40 T A 3: 158,066,229 probably benign Het
Lrrc9 A G 12: 72,499,692 N1218S possibly damaging Het
Map3k9 A G 12: 81,724,627 V729A probably benign Het
Marf1 A T 16: 14,128,611 Y1215* probably null Het
Moap1 T A 12: 102,742,565 I242L probably benign Het
Mpo A G 11: 87,796,281 K218E probably benign Het
Mpz C T 1: 171,158,810 R98C probably damaging Het
Neb T G 2: 52,201,980 K5024T probably damaging Het
Nlrp4b C T 7: 10,715,298 T109I probably benign Het
Noc3l T A 19: 38,792,800 probably null Het
Nosip G A 7: 45,076,678 V220I probably benign Het
Nyap1 A C 5: 137,735,578 S398A probably damaging Het
Olfr109 A G 17: 37,466,823 M206V possibly damaging Het
Olfr1240 T G 2: 89,439,623 I219L probably damaging Het
Olfr1278 A G 2: 111,293,143 N292D possibly damaging Het
Osbpl7 T C 11: 97,056,669 probably benign Het
Pard3 A T 8: 127,324,054 Y199F probably damaging Het
Pcdha11 G A 18: 37,011,452 V199I probably benign Het
Pcdhga8 A T 18: 37,726,914 N341I probably damaging Het
Pcsk4 A G 10: 80,325,039 S318P probably damaging Het
Phldb1 C A 9: 44,696,092 R1272L probably damaging Het
Phlpp2 A G 8: 109,877,010 T103A probably damaging Het
Pibf1 T A 14: 99,186,501 Y503* probably null Het
Pkn1 A T 8: 83,684,227 probably null Het
Ptprf A G 4: 118,217,197 probably benign Het
Rbm19 C A 5: 120,132,833 probably benign Het
Rcan1 T C 16: 92,465,906 D5G possibly damaging Het
Recql5 A T 11: 115,928,212 L176Q probably damaging Het
Rev3l T A 10: 39,838,459 L2393Q probably damaging Het
Rp1 C A 1: 4,352,316 K180N probably damaging Het
Rp1 T A 1: 4,352,317 K180M probably damaging Het
Sdk1 T C 5: 142,161,776 V1461A probably benign Het
Sdk2 A T 11: 113,821,382 L1653* probably null Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Skint10 A T 4: 112,746,633 V119D possibly damaging Het
Sncaip T C 18: 52,869,225 S273P probably benign Het
Sp1 T G 15: 102,430,974 I449S probably damaging Het
Spats2 T C 15: 99,174,420 L78P probably damaging Het
Spert C T 14: 75,593,038 E8K probably damaging Het
Stambp T A 6: 83,556,366 N305I probably benign Het
Stim2 A T 5: 54,118,546 S688C probably damaging Het
Sytl3 A G 17: 6,736,581 N355S probably damaging Het
Taf4b C T 18: 14,804,578 A236V probably null Het
Tnfaip6 A G 2: 52,051,074 probably null Het
Trpc2 T A 7: 102,083,969 S416T probably benign Het
Ttn T C 2: 76,738,866 T27228A probably damaging Het
Uhrf1bp1l A T 10: 89,779,963 N156I probably damaging Het
Ush2a T A 1: 188,537,720 D1721E probably benign Het
Usp47 T A 7: 112,082,552 H523Q probably damaging Het
Vmn1r8 A T 6: 57,036,353 I130F probably benign Het
Vps13b A G 15: 35,456,654 S749G probably benign Het
Xrcc5 C A 1: 72,326,265 T283K possibly damaging Het
Ydjc A G 16: 17,148,138 probably benign Het
Other mutations in Dnah5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00226:Dnah5 APN 15 28272342 missense probably benign
IGL00331:Dnah5 APN 15 28421620 missense probably damaging 1.00
IGL00519:Dnah5 APN 15 28444218 missense probably benign 0.10
IGL00537:Dnah5 APN 15 28458702 critical splice donor site probably null
IGL01102:Dnah5 APN 15 28410003 critical splice donor site probably null
IGL01126:Dnah5 APN 15 28302399 missense possibly damaging 0.85
IGL01154:Dnah5 APN 15 28458656 missense possibly damaging 0.75
IGL01349:Dnah5 APN 15 28294913 splice site probably benign
IGL01353:Dnah5 APN 15 28233272 missense probably benign 0.00
IGL01372:Dnah5 APN 15 28230490 missense probably benign 0.00
IGL01390:Dnah5 APN 15 28411540 missense probably benign 0.00
IGL01446:Dnah5 APN 15 28326669 missense probably damaging 1.00
IGL01472:Dnah5 APN 15 28331726 missense probably damaging 1.00
IGL01485:Dnah5 APN 15 28331726 missense probably damaging 1.00
IGL01568:Dnah5 APN 15 28229652 missense probably benign 0.01
IGL01592:Dnah5 APN 15 28236637 missense probably benign 0.01
IGL01594:Dnah5 APN 15 28311334 missense possibly damaging 0.87
IGL01677:Dnah5 APN 15 28367782 missense probably damaging 1.00
IGL01845:Dnah5 APN 15 28449169 missense probably benign 0.06
IGL01904:Dnah5 APN 15 28307364 missense probably benign 0.09
IGL01913:Dnah5 APN 15 28313753 missense possibly damaging 0.50
IGL01950:Dnah5 APN 15 28290289 missense probably null 1.00
IGL01963:Dnah5 APN 15 28370536 missense probably benign 0.12
IGL02008:Dnah5 APN 15 28343552 missense probably damaging 0.98
IGL02088:Dnah5 APN 15 28459118 critical splice acceptor site probably null
IGL02090:Dnah5 APN 15 28240041 splice site probably benign
IGL02114:Dnah5 APN 15 28397124 missense probably damaging 0.97
IGL02135:Dnah5 APN 15 28247885 missense possibly damaging 0.50
IGL02232:Dnah5 APN 15 28299240 missense probably damaging 1.00
IGL02386:Dnah5 APN 15 28340381 missense probably damaging 1.00
IGL02475:Dnah5 APN 15 28219150 missense probably benign 0.09
IGL02626:Dnah5 APN 15 28307276 missense possibly damaging 0.94
IGL02650:Dnah5 APN 15 28289047 splice site probably benign
IGL02651:Dnah5 APN 15 28350622 missense probably benign 0.05
IGL02652:Dnah5 APN 15 28366187 missense probably damaging 0.99
IGL02670:Dnah5 APN 15 28409296 missense probably damaging 1.00
IGL02697:Dnah5 APN 15 28445143 missense probably benign 0.00
IGL02721:Dnah5 APN 15 28234243 critical splice acceptor site probably null
IGL02858:Dnah5 APN 15 28453212 missense possibly damaging 0.65
IGL02859:Dnah5 APN 15 28383625 missense probably benign 0.01
IGL02945:Dnah5 APN 15 28270426 missense probably benign 0.00
IGL02949:Dnah5 APN 15 28272185 missense probably benign 0.32
IGL02971:Dnah5 APN 15 28384461 missense probably damaging 1.00
IGL03017:Dnah5 APN 15 28340325 missense possibly damaging 0.93
IGL03177:Dnah5 APN 15 28295399 missense probably damaging 0.97
IGL03212:Dnah5 APN 15 28290163 missense probably benign 0.08
IGL03224:Dnah5 APN 15 28459154 missense probably damaging 1.00
IGL03231:Dnah5 APN 15 28311148 missense probably damaging 1.00
IGL03273:Dnah5 APN 15 28458649 missense probably damaging 0.98
IGL03294:Dnah5 APN 15 28233295 critical splice donor site probably null
IGL03331:Dnah5 APN 15 28419940 missense probably damaging 1.00
IGL03337:Dnah5 APN 15 28290141 missense probably benign 0.10
IGL03367:Dnah5 APN 15 28234327 missense possibly damaging 0.95
IGL02837:Dnah5 UTSW 15 28269400 missense probably benign
P0008:Dnah5 UTSW 15 28302387 missense probably damaging 1.00
P0014:Dnah5 UTSW 15 28403473 missense probably damaging 1.00
PIT4687001:Dnah5 UTSW 15 28383577 missense probably damaging 0.98
R0030:Dnah5 UTSW 15 28451517 missense probably benign 0.34
R0087:Dnah5 UTSW 15 28350613 missense probably damaging 1.00
R0099:Dnah5 UTSW 15 28239934 missense probably damaging 1.00
R0102:Dnah5 UTSW 15 28245751 splice site probably benign
R0102:Dnah5 UTSW 15 28245751 splice site probably benign
R0104:Dnah5 UTSW 15 28453353 missense possibly damaging 0.88
R0112:Dnah5 UTSW 15 28263679 missense probably benign 0.00
R0122:Dnah5 UTSW 15 28378363 missense probably damaging 1.00
R0126:Dnah5 UTSW 15 28246319 missense probably benign 0.00
R0127:Dnah5 UTSW 15 28294925 missense probably damaging 1.00
R0233:Dnah5 UTSW 15 28333070 missense probably damaging 1.00
R0310:Dnah5 UTSW 15 28299110 missense probably benign 0.19
R0386:Dnah5 UTSW 15 28383581 missense probably damaging 1.00
R0421:Dnah5 UTSW 15 28229541 missense possibly damaging 0.79
R0481:Dnah5 UTSW 15 28383599 missense probably benign 0.31
R0514:Dnah5 UTSW 15 28366321 missense probably damaging 1.00
R0609:Dnah5 UTSW 15 28327779 missense probably benign
R0720:Dnah5 UTSW 15 28313861 missense probably null 0.98
R0731:Dnah5 UTSW 15 28311143 missense possibly damaging 0.78
R0747:Dnah5 UTSW 15 28444186 missense probably damaging 0.99
R0747:Dnah5 UTSW 15 28444187 missense possibly damaging 0.64
R0766:Dnah5 UTSW 15 28448487 missense probably null 0.89
R0849:Dnah5 UTSW 15 28263599 missense probably damaging 0.96
R1034:Dnah5 UTSW 15 28302471 missense probably damaging 1.00
R1084:Dnah5 UTSW 15 28343452 missense probably benign 0.01
R1148:Dnah5 UTSW 15 28421690 missense probably damaging 1.00
R1148:Dnah5 UTSW 15 28421690 missense probably damaging 1.00
R1200:Dnah5 UTSW 15 28246257 missense possibly damaging 0.88
R1208:Dnah5 UTSW 15 28327731 missense probably damaging 1.00
R1208:Dnah5 UTSW 15 28327731 missense probably damaging 1.00
R1269:Dnah5 UTSW 15 28238511 missense probably damaging 1.00
R1373:Dnah5 UTSW 15 28313918 splice site probably benign
R1401:Dnah5 UTSW 15 28401913 missense probably damaging 1.00
R1413:Dnah5 UTSW 15 28370409 missense probably benign
R1430:Dnah5 UTSW 15 28345857 missense probably benign 0.37
R1457:Dnah5 UTSW 15 28403542 critical splice donor site probably null
R1468:Dnah5 UTSW 15 28230463 nonsense probably null
R1468:Dnah5 UTSW 15 28230463 nonsense probably null
R1560:Dnah5 UTSW 15 28420003 missense probably damaging 1.00
R1568:Dnah5 UTSW 15 28409177 missense probably damaging 0.98
R1574:Dnah5 UTSW 15 28252423 missense probably benign 0.00
R1574:Dnah5 UTSW 15 28252423 missense probably benign 0.00
R1603:Dnah5 UTSW 15 28294985 splice site probably benign
R1603:Dnah5 UTSW 15 28449180 missense probably benign 0.09
R1673:Dnah5 UTSW 15 28290148 missense probably benign
R1755:Dnah5 UTSW 15 28326636 missense probably damaging 0.99
R1785:Dnah5 UTSW 15 28313786 missense probably damaging 1.00
R1786:Dnah5 UTSW 15 28313786 missense probably damaging 1.00
R1789:Dnah5 UTSW 15 28270426 missense probably benign 0.00
R1817:Dnah5 UTSW 15 28246400 nonsense probably null
R1819:Dnah5 UTSW 15 28246400 nonsense probably null
R1834:Dnah5 UTSW 15 28409124 missense probably benign 0.00
R1855:Dnah5 UTSW 15 28411669 missense possibly damaging 0.88
R1870:Dnah5 UTSW 15 28331713 nonsense probably null
R1871:Dnah5 UTSW 15 28331713 nonsense probably null
R1987:Dnah5 UTSW 15 28343591 missense probably damaging 0.99
R1988:Dnah5 UTSW 15 28343591 missense probably damaging 0.99
R1989:Dnah5 UTSW 15 28343591 missense probably damaging 0.99
R2062:Dnah5 UTSW 15 28366270 missense probably damaging 1.00
R2069:Dnah5 UTSW 15 28312388 splice site probably null
R2121:Dnah5 UTSW 15 28297005 splice site probably benign
R2128:Dnah5 UTSW 15 28408321 missense probably benign 0.00
R2129:Dnah5 UTSW 15 28408321 missense probably benign 0.00
R2151:Dnah5 UTSW 15 28444091 missense probably damaging 1.00
R2159:Dnah5 UTSW 15 28252545 missense probably benign 0.00
R2207:Dnah5 UTSW 15 28343671 missense probably benign 0.11
R2231:Dnah5 UTSW 15 28408417 critical splice donor site probably null
R2232:Dnah5 UTSW 15 28408417 critical splice donor site probably null
R2282:Dnah5 UTSW 15 28327302 missense probably damaging 0.99
R2305:Dnah5 UTSW 15 28387767 missense probably benign 0.25
R2339:Dnah5 UTSW 15 28313882 missense probably benign 0.00
R2437:Dnah5 UTSW 15 28307391 critical splice donor site probably null
R2696:Dnah5 UTSW 15 28278576 missense probably benign 0.00
R3156:Dnah5 UTSW 15 28438091 splice site probably benign
R3431:Dnah5 UTSW 15 28295267 missense probably benign 0.20
R3700:Dnah5 UTSW 15 28387791 missense possibly damaging 0.72
R3724:Dnah5 UTSW 15 28270420 missense probably benign 0.08
R3732:Dnah5 UTSW 15 28409122 missense possibly damaging 0.64
R3872:Dnah5 UTSW 15 28411510 missense possibly damaging 0.50
R4063:Dnah5 UTSW 15 28420998 missense probably damaging 0.98
R4072:Dnah5 UTSW 15 28340298 nonsense probably null
R4075:Dnah5 UTSW 15 28293791 missense probably benign
R4245:Dnah5 UTSW 15 28219189 missense probably benign
R4254:Dnah5 UTSW 15 28438102 missense probably benign 0.07
R4255:Dnah5 UTSW 15 28438102 missense probably benign 0.07
R4392:Dnah5 UTSW 15 28289229 missense probably benign 0.19
R4552:Dnah5 UTSW 15 28397154 missense probably benign 0.19
R4574:Dnah5 UTSW 15 28367763 missense probably benign 0.05
R4577:Dnah5 UTSW 15 28289250 missense probably benign 0.06
R4587:Dnah5 UTSW 15 28304599 missense probably damaging 1.00
R4631:Dnah5 UTSW 15 28401953 missense probably damaging 1.00
R4631:Dnah5 UTSW 15 28419994 missense probably damaging 1.00
R4676:Dnah5 UTSW 15 28295260 missense possibly damaging 0.65
R4707:Dnah5 UTSW 15 28372375 missense probably damaging 0.97
R4754:Dnah5 UTSW 15 28420955 splice site probably null
R4767:Dnah5 UTSW 15 28270474 missense probably benign 0.02
R4883:Dnah5 UTSW 15 28343638 missense probably benign 0.00
R4889:Dnah5 UTSW 15 28235792 missense probably benign 0.01
R4946:Dnah5 UTSW 15 28326557 missense probably damaging 0.96
R4946:Dnah5 UTSW 15 28387904 missense probably damaging 1.00
R4947:Dnah5 UTSW 15 28272372 missense probably benign
R5033:Dnah5 UTSW 15 28421678 missense probably damaging 0.96
R5164:Dnah5 UTSW 15 28408292 missense probably benign 0.00
R5175:Dnah5 UTSW 15 28448404 missense probably damaging 1.00
R5182:Dnah5 UTSW 15 28311278 missense probably damaging 0.99
R5187:Dnah5 UTSW 15 28272172 missense probably benign 0.41
R5272:Dnah5 UTSW 15 28350665 missense probably benign
R5308:Dnah5 UTSW 15 28229651 missense possibly damaging 0.80
R5310:Dnah5 UTSW 15 28311328 missense probably damaging 1.00
R5322:Dnah5 UTSW 15 28384244 missense probably benign 0.41
R5398:Dnah5 UTSW 15 28293726 missense probably benign
R5596:Dnah5 UTSW 15 28343608 missense probably damaging 1.00
R5603:Dnah5 UTSW 15 28419932 missense probably damaging 1.00
R5619:Dnah5 UTSW 15 28302435 missense probably damaging 1.00
R5656:Dnah5 UTSW 15 28421064 missense probably benign 0.03
R5741:Dnah5 UTSW 15 28246367 missense probably benign 0.11
R5754:Dnah5 UTSW 15 28401868 missense probably benign 0.01
R5763:Dnah5 UTSW 15 28311152 missense probably damaging 1.00
R5824:Dnah5 UTSW 15 28313821 missense probably benign 0.00
R5836:Dnah5 UTSW 15 28383592 missense probably damaging 1.00
R5838:Dnah5 UTSW 15 28290195 missense probably benign 0.00
R5864:Dnah5 UTSW 15 28297013 missense possibly damaging 0.83
R5895:Dnah5 UTSW 15 28234453 intron probably null
R5896:Dnah5 UTSW 15 28272060 missense probably benign
R5899:Dnah5 UTSW 15 28448367 missense possibly damaging 0.95
R5905:Dnah5 UTSW 15 28387833 missense probably damaging 1.00
R5924:Dnah5 UTSW 15 28307327 missense probably benign 0.41
R5927:Dnah5 UTSW 15 28335718 missense probably benign 0.00
R5929:Dnah5 UTSW 15 28311207 missense probably benign 0.01
R5929:Dnah5 UTSW 15 28311208 missense probably damaging 1.00
R5931:Dnah5 UTSW 15 28453279 missense probably damaging 0.99
R5964:Dnah5 UTSW 15 28458584 missense possibly damaging 0.49
R5975:Dnah5 UTSW 15 28234282 missense probably damaging 1.00
R5993:Dnah5 UTSW 15 28299226 missense probably benign 0.09
R6016:Dnah5 UTSW 15 28327884 missense probably damaging 1.00
R6028:Dnah5 UTSW 15 28387833 missense probably damaging 1.00
R6065:Dnah5 UTSW 15 28230468 missense possibly damaging 0.47
R6117:Dnah5 UTSW 15 28270420 missense probably damaging 0.99
R6143:Dnah5 UTSW 15 28233231 missense probably benign 0.05
R6146:Dnah5 UTSW 15 28459185 missense probably benign
R6154:Dnah5 UTSW 15 28204031 missense probably benign 0.15
R6164:Dnah5 UTSW 15 28378343 missense probably benign 0.08
R6266:Dnah5 UTSW 15 28335627 missense possibly damaging 0.67
R6321:Dnah5 UTSW 15 28372411 missense probably damaging 0.99
R6349:Dnah5 UTSW 15 28238511 missense probably damaging 1.00
R6431:Dnah5 UTSW 15 28349824 missense possibly damaging 0.52
R6467:Dnah5 UTSW 15 28438183 missense probably benign 0.10
R6564:Dnah5 UTSW 15 28367745 missense probably benign
R6607:Dnah5 UTSW 15 28445200 missense possibly damaging 0.95
R6619:Dnah5 UTSW 15 28409120 missense probably benign 0.03
R6633:Dnah5 UTSW 15 28293787 missense probably benign 0.27
R6647:Dnah5 UTSW 15 28403487 missense probably benign 0.02
R6782:Dnah5 UTSW 15 28449156 missense possibly damaging 0.89
R6797:Dnah5 UTSW 15 28233238 nonsense probably null
R6797:Dnah5 UTSW 15 28451463 missense probably damaging 1.00
R6831:Dnah5 UTSW 15 28411515 missense possibly damaging 0.88
R6849:Dnah5 UTSW 15 28278624 missense probably benign 0.14
R6871:Dnah5 UTSW 15 28229640 missense probably benign 0.32
R6936:Dnah5 UTSW 15 28409268 missense probably damaging 1.00
R6943:Dnah5 UTSW 15 28235720 missense probably damaging 1.00
R7030:Dnah5 UTSW 15 28238592 missense probably benign
R7030:Dnah5 UTSW 15 28333062 missense probably benign 0.00
R7032:Dnah5 UTSW 15 28326650 missense probably damaging 1.00
R7063:Dnah5 UTSW 15 28233248 missense probably benign 0.00
R7094:Dnah5 UTSW 15 28453336 missense probably damaging 0.98
R7097:Dnah5 UTSW 15 28453264 missense probably benign 0.00
R7126:Dnah5 UTSW 15 28349837 missense probably benign 0.03
R7209:Dnah5 UTSW 15 28459225 missense possibly damaging 0.71
R7276:Dnah5 UTSW 15 28367838 missense probably damaging 1.00
R7320:Dnah5 UTSW 15 28270470 missense probably null 0.33
X0011:Dnah5 UTSW 15 28408381 missense probably benign 0.16
X0018:Dnah5 UTSW 15 28269354 missense probably benign 0.00
X0022:Dnah5 UTSW 15 28270411 missense probably benign 0.01
X0023:Dnah5 UTSW 15 28384308 missense probably damaging 0.99
X0028:Dnah5 UTSW 15 28470477 missense probably damaging 1.00
Z1088:Dnah5 UTSW 15 28366357 missense probably null 0.10
Z1088:Dnah5 UTSW 15 28384230 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGACCAGCACACGTGAATG -3'
(R):5'- AACCGGTGCTTCTGAAACCTC -3'

Sequencing Primer
(F):5'- CAGGCTTGATGGCATCTTAAGCAC -3'
(R):5'- GTGCTTCTGAAACCTCTCCCAAC -3'
Posted On2016-03-01