Incidental Mutation 'R4826:Nt5c1a'
ID374133
Institutional Source Beutler Lab
Gene Symbol Nt5c1a
Ensembl Gene ENSMUSG00000054958
Gene Name5'-nucleotidase, cytosolic IA
SynonymsLOC230718, Cn1a
MMRRC Submission 042442-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.146) question?
Stock #R4826 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location123201504-123216275 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 123208572 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 97 (V97A)
Ref Sequence ENSEMBL: ENSMUSP00000069422 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068262]
Predicted Effect probably damaging
Transcript: ENSMUST00000068262
AA Change: V97A

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000069422
Gene: ENSMUSG00000054958
AA Change: V97A

DomainStartEndE-ValueType
low complexity region 35 45 N/A INTRINSIC
Pfam:5-nucleotidase 78 350 3.5e-109 PFAM
Meta Mutation Damage Score 0.332 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.0%
Validation Efficiency 100% (72/72)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Cytosolic nucleotidases, such as NT5C1A, dephosphorylate nucleoside monophosphates (Hunsucker et al., 2001 [PubMed 11133996]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110002H16Rik G T 18: 12,185,779 probably benign Het
Abca14 A T 7: 120,216,247 R239S probably damaging Het
Acin1 A G 14: 54,664,617 S573P probably damaging Het
Acta2 A T 19: 34,251,823 Y55* probably null Het
Aifm2 T C 10: 61,725,989 M38T probably benign Het
Ank2 C A 3: 126,956,001 V460L probably benign Het
Ap1b1 T C 11: 5,018,043 S185P probably benign Het
Arsj A G 3: 126,438,802 Y399C probably damaging Het
Clec2d T C 6: 129,184,159 V73A probably benign Het
Cntln T G 4: 85,005,044 M582R probably benign Het
Cyp4a10 C T 4: 115,518,344 P8L probably benign Het
Dip2b A G 15: 100,169,281 N555D probably damaging Het
Dusp4 T A 8: 34,818,517 F311I probably damaging Het
Eif4g3 T C 4: 138,177,945 V1245A possibly damaging Het
Ephb3 G A 16: 21,214,995 R23H possibly damaging Het
Ext2 T C 2: 93,762,630 T410A probably benign Het
Fam193a A G 5: 34,436,531 E124G probably damaging Het
Fat4 T A 3: 38,982,957 V3586E probably damaging Het
Frmd4a T C 2: 4,601,297 S611P probably damaging Het
Gcn1l1 A G 5: 115,593,693 T956A probably benign Het
Gm10549 C A 18: 33,470,785 T107K unknown Het
Gm7102 C T 19: 61,175,926 G24R unknown Het
Herc6 T A 6: 57,647,087 M614K probably benign Het
Hspg2 T C 4: 137,565,395 C4095R probably damaging Het
Hyal5 T C 6: 24,891,576 I463T possibly damaging Het
Icam5 C T 9: 21,037,803 A817V possibly damaging Het
Igf2r A T 17: 12,701,353 D1366E probably damaging Het
Ints7 G A 1: 191,611,906 V553I probably damaging Het
Iqgap2 T A 13: 95,763,275 I92F probably damaging Het
Itgb1 T A 8: 128,720,308 C435S probably damaging Het
Lrrc71 T C 3: 87,743,308 M216V probably benign Het
Mgam T C 6: 40,680,648 V979A possibly damaging Het
Myh9 A T 15: 77,788,946 Y400* probably null Het
Narfl A G 17: 25,780,332 H240R probably damaging Het
Nbeal1 A G 1: 60,251,342 R1033G possibly damaging Het
Nit1 T C 1: 171,345,598 probably benign Het
Nlrp1c-ps A G 11: 71,242,517 noncoding transcript Het
Olfr1154 T A 2: 87,903,349 D109V probably damaging Het
Olfr358 A G 2: 37,005,333 Y94H probably damaging Het
Olfr43 A G 11: 74,206,331 M295T possibly damaging Het
Olfr46 T A 7: 140,610,319 M51K probably benign Het
Olfr683 G T 7: 105,143,968 N108K probably damaging Het
Pde4a T A 9: 21,192,380 probably null Het
Pkn2 T C 3: 142,809,509 K640R probably damaging Het
Pla2g6 A G 15: 79,308,679 S263P possibly damaging Het
Prkg1 A G 19: 31,764,606 S73P possibly damaging Het
Prr27 A C 5: 87,850,966 probably benign Het
Rad54b G T 4: 11,599,753 W319L probably damaging Het
Rassf8 T A 6: 145,816,550 L349H probably damaging Het
Rnf113a2 T A 12: 84,417,614 N93K probably benign Het
Sapcd2 C T 2: 25,372,756 A109V probably benign Het
Slamf9 C A 1: 172,476,441 H118N probably benign Het
Slc37a1 A G 17: 31,322,173 Y213C probably damaging Het
Slc5a1 A G 5: 33,159,150 D580G probably benign Het
Slc7a2 T A 8: 40,911,046 I432N probably damaging Het
Tas2r114 A T 6: 131,689,837 L76Q probably damaging Het
Tcerg1 C T 18: 42,535,115 P391L unknown Het
Tdrd12 A C 7: 35,504,157 V314G probably benign Het
Zbtb7b A G 3: 89,380,773 L246S probably benign Het
Other mutations in Nt5c1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01444:Nt5c1a APN 4 123216169 missense probably damaging 1.00
IGL02035:Nt5c1a APN 4 123214102 missense possibly damaging 0.93
IGL02437:Nt5c1a APN 4 123214241 missense probably benign 0.25
IGL02877:Nt5c1a APN 4 123216074 missense probably damaging 1.00
R1628:Nt5c1a UTSW 4 123208491 missense possibly damaging 0.65
R2273:Nt5c1a UTSW 4 123216080 missense probably damaging 1.00
R2275:Nt5c1a UTSW 4 123216080 missense probably damaging 1.00
R4433:Nt5c1a UTSW 4 123215896 missense probably benign 0.01
R5328:Nt5c1a UTSW 4 123208993 missense possibly damaging 0.90
R5690:Nt5c1a UTSW 4 123215939 missense probably damaging 1.00
R5883:Nt5c1a UTSW 4 123216256 utr 3 prime probably null
Predicted Primers PCR Primer
(F):5'- GATGGGATTGAGTGACAGCC -3'
(R):5'- CTCGGTGGCACCTTGTTAAAG -3'

Sequencing Primer
(F):5'- GATTGAGTGACAGCCTGTTTTAC -3'
(R):5'- CCTTGTTAAAGGTGGATGGAGG -3'
Posted On2016-03-01