Incidental Mutation 'R4826:Mgam'
ID374143
Institutional Source Beutler Lab
Gene Symbol Mgam
Ensembl Gene ENSMUSG00000068587
Gene Namemaltase-glucoamylase
Synonyms6030407P20Rik
MMRRC Submission 042442-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.111) question?
Stock #R4826 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location40628831-40769123 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 40680648 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 979 (V979A)
Ref Sequence ENSEMBL: ENSMUSP00000143946 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071535] [ENSMUST00000201148] [ENSMUST00000202966]
Predicted Effect possibly damaging
Transcript: ENSMUST00000071535
AA Change: V979A

PolyPhen 2 Score 0.523 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000071466
Gene: ENSMUSG00000068587
AA Change: V979A

DomainStartEndE-ValueType
transmembrane domain 12 34 N/A INTRINSIC
low complexity region 47 59 N/A INTRINSIC
PD 63 111 1.81e-8 SMART
Pfam:NtCtMGAM_N 124 233 6.2e-36 PFAM
Pfam:Glyco_hydro_31 323 795 3.4e-145 PFAM
PD 924 977 4.52e-9 SMART
Pfam:NtCtMGAM_N 988 1101 1.5e-30 PFAM
Blast:ANK 1141 1171 1e-7 BLAST
Pfam:Glyco_hydro_31 1189 1691 2e-139 PFAM
low complexity region 1776 1791 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000201148
AA Change: V979A

PolyPhen 2 Score 0.523 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000143946
Gene: ENSMUSG00000068587
AA Change: V979A

DomainStartEndE-ValueType
transmembrane domain 12 34 N/A INTRINSIC
low complexity region 47 59 N/A INTRINSIC
PD 63 111 1.81e-8 SMART
Pfam:NtCtMGAM_N 124 233 6.2e-36 PFAM
Pfam:Glyco_hydro_31 323 795 3.4e-145 PFAM
PD 924 977 4.52e-9 SMART
Pfam:NtCtMGAM_N 988 1101 1.5e-30 PFAM
Blast:ANK 1141 1171 1e-7 BLAST
Pfam:Glyco_hydro_31 1189 1691 2e-139 PFAM
low complexity region 1776 1791 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000202966
SMART Domains Protein: ENSMUSP00000144680
Gene: ENSMUSG00000068587

DomainStartEndE-ValueType
internal_repeat_1 2 88 2.6e-19 PROSPERO
PD 178 231 1.4e-14 SMART
Pfam:NtCtMGAM_N 242 355 1.1e-26 PFAM
Blast:ANK 395 425 6e-8 BLAST
Pfam:Glyco_hydro_31 443 945 1.3e-137 PFAM
Meta Mutation Damage Score 0.012 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.0%
Validation Efficiency 100% (72/72)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes maltase-glucoamylase, which is a brush border membrane enzyme that plays a role in the final steps of digestion of starch. The protein has two catalytic sites identical to those of sucrase-isomaltase, but the proteins are only 59% homologous. Both are members of glycosyl hydrolase family 31, which has a variety of substrate specificities. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele display abnormalities in starch digestion and prandial glucose homeostasis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110002H16Rik G T 18: 12,185,779 probably benign Het
Abca14 A T 7: 120,216,247 R239S probably damaging Het
Acin1 A G 14: 54,664,617 S573P probably damaging Het
Acta2 A T 19: 34,251,823 Y55* probably null Het
Aifm2 T C 10: 61,725,989 M38T probably benign Het
Ank2 C A 3: 126,956,001 V460L probably benign Het
Ap1b1 T C 11: 5,018,043 S185P probably benign Het
Arsj A G 3: 126,438,802 Y399C probably damaging Het
Clec2d T C 6: 129,184,159 V73A probably benign Het
Cntln T G 4: 85,005,044 M582R probably benign Het
Cyp4a10 C T 4: 115,518,344 P8L probably benign Het
Dip2b A G 15: 100,169,281 N555D probably damaging Het
Dusp4 T A 8: 34,818,517 F311I probably damaging Het
Eif4g3 T C 4: 138,177,945 V1245A possibly damaging Het
Ephb3 G A 16: 21,214,995 R23H possibly damaging Het
Ext2 T C 2: 93,762,630 T410A probably benign Het
Fam193a A G 5: 34,436,531 E124G probably damaging Het
Fat4 T A 3: 38,982,957 V3586E probably damaging Het
Frmd4a T C 2: 4,601,297 S611P probably damaging Het
Gcn1l1 A G 5: 115,593,693 T956A probably benign Het
Gm10549 C A 18: 33,470,785 T107K unknown Het
Gm7102 C T 19: 61,175,926 G24R unknown Het
Herc6 T A 6: 57,647,087 M614K probably benign Het
Hspg2 T C 4: 137,565,395 C4095R probably damaging Het
Hyal5 T C 6: 24,891,576 I463T possibly damaging Het
Icam5 C T 9: 21,037,803 A817V possibly damaging Het
Igf2r A T 17: 12,701,353 D1366E probably damaging Het
Ints7 G A 1: 191,611,906 V553I probably damaging Het
Iqgap2 T A 13: 95,763,275 I92F probably damaging Het
Itgb1 T A 8: 128,720,308 C435S probably damaging Het
Lrrc71 T C 3: 87,743,308 M216V probably benign Het
Myh9 A T 15: 77,788,946 Y400* probably null Het
Narfl A G 17: 25,780,332 H240R probably damaging Het
Nbeal1 A G 1: 60,251,342 R1033G possibly damaging Het
Nit1 T C 1: 171,345,598 probably benign Het
Nlrp1c-ps A G 11: 71,242,517 noncoding transcript Het
Nt5c1a T C 4: 123,208,572 V97A probably damaging Het
Olfr1154 T A 2: 87,903,349 D109V probably damaging Het
Olfr358 A G 2: 37,005,333 Y94H probably damaging Het
Olfr43 A G 11: 74,206,331 M295T possibly damaging Het
Olfr46 T A 7: 140,610,319 M51K probably benign Het
Olfr683 G T 7: 105,143,968 N108K probably damaging Het
Pde4a T A 9: 21,192,380 probably null Het
Pkn2 T C 3: 142,809,509 K640R probably damaging Het
Pla2g6 A G 15: 79,308,679 S263P possibly damaging Het
Prkg1 A G 19: 31,764,606 S73P possibly damaging Het
Prr27 A C 5: 87,850,966 probably benign Het
Rad54b G T 4: 11,599,753 W319L probably damaging Het
Rassf8 T A 6: 145,816,550 L349H probably damaging Het
Rnf113a2 T A 12: 84,417,614 N93K probably benign Het
Sapcd2 C T 2: 25,372,756 A109V probably benign Het
Slamf9 C A 1: 172,476,441 H118N probably benign Het
Slc37a1 A G 17: 31,322,173 Y213C probably damaging Het
Slc5a1 A G 5: 33,159,150 D580G probably benign Het
Slc7a2 T A 8: 40,911,046 I432N probably damaging Het
Tas2r114 A T 6: 131,689,837 L76Q probably damaging Het
Tcerg1 C T 18: 42,535,115 P391L unknown Het
Tdrd12 A C 7: 35,504,157 V314G probably benign Het
Zbtb7b A G 3: 89,380,773 L246S probably benign Het
Other mutations in Mgam
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01024:Mgam APN 6 40643010 missense probably benign
IGL01065:Mgam APN 6 40662710 critical splice donor site probably null
IGL01402:Mgam APN 6 40644945 missense probably benign 0.01
IGL01404:Mgam APN 6 40644945 missense probably benign 0.01
IGL01413:Mgam APN 6 40661277 missense probably damaging 1.00
IGL01546:Mgam APN 6 40654693 missense probably damaging 0.98
IGL01596:Mgam APN 6 40658270 missense probably damaging 1.00
IGL02133:Mgam APN 6 40643076 missense probably damaging 0.98
IGL02734:Mgam APN 6 40662694 missense probably damaging 1.00
R0012:Mgam UTSW 6 40765256 splice site probably null
R0116:Mgam UTSW 6 40658987 missense probably damaging 1.00
R0310:Mgam UTSW 6 40761035 splice site probably benign
R0452:Mgam UTSW 6 40759090 missense probably damaging 1.00
R0497:Mgam UTSW 6 40664892 missense probably damaging 1.00
R0699:Mgam UTSW 6 40643019 missense possibly damaging 0.84
R0738:Mgam UTSW 6 40754935 missense probably benign 0.01
R1033:Mgam UTSW 6 40680624 missense probably benign 0.07
R1403:Mgam UTSW 6 40666881 missense possibly damaging 0.93
R1403:Mgam UTSW 6 40666881 missense possibly damaging 0.93
R1430:Mgam UTSW 6 40756371 missense probably benign 0.08
R1432:Mgam UTSW 6 40756367 missense probably damaging 1.00
R1443:Mgam UTSW 6 40759780 nonsense probably null
R1470:Mgam UTSW 6 40759128 missense probably damaging 1.00
R1470:Mgam UTSW 6 40759128 missense probably damaging 1.00
R1519:Mgam UTSW 6 40661683 missense probably benign 0.45
R1654:Mgam UTSW 6 40757487 missense probably damaging 1.00
R1667:Mgam UTSW 6 40677044 missense possibly damaging 0.62
R1730:Mgam UTSW 6 40664860 missense possibly damaging 0.92
R1781:Mgam UTSW 6 40669863 missense probably damaging 1.00
R1783:Mgam UTSW 6 40664860 missense possibly damaging 0.92
R1829:Mgam UTSW 6 40666892 missense probably damaging 1.00
R1833:Mgam UTSW 6 40654718 critical splice donor site probably null
R1872:Mgam UTSW 6 40661300 nonsense probably null
R1912:Mgam UTSW 6 40764185 nonsense probably null
R1977:Mgam UTSW 6 40664880 missense probably benign 0.01
R2048:Mgam UTSW 6 40656429 missense possibly damaging 0.80
R2086:Mgam UTSW 6 40761028 splice site probably null
R2138:Mgam UTSW 6 40756450 missense probably damaging 1.00
R2224:Mgam UTSW 6 40764274 unclassified probably null
R2408:Mgam UTSW 6 40686522 missense probably damaging 1.00
R2508:Mgam UTSW 6 40759783 missense probably damaging 1.00
R2842:Mgam UTSW 6 40661345 missense probably benign 0.01
R2847:Mgam UTSW 6 40652715 missense possibly damaging 0.67
R2848:Mgam UTSW 6 40652715 missense possibly damaging 0.67
R2965:Mgam UTSW 6 40768220 missense possibly damaging 0.46
R2966:Mgam UTSW 6 40768220 missense possibly damaging 0.46
R3035:Mgam UTSW 6 40663530 missense probably benign
R3895:Mgam UTSW 6 40759120 missense probably damaging 1.00
R4027:Mgam UTSW 6 40754902 missense probably damaging 1.00
R4030:Mgam UTSW 6 40754902 missense probably damaging 1.00
R4302:Mgam UTSW 6 40763085 missense probably benign 0.02
R4707:Mgam UTSW 6 40714632 intron probably null
R4898:Mgam UTSW 6 40643054 missense probably benign
R5438:Mgam UTSW 6 40684521 missense probably damaging 1.00
R5492:Mgam UTSW 6 40756363 missense probably damaging 1.00
R5770:Mgam UTSW 6 40669804 missense probably benign 0.01
R5839:Mgam UTSW 6 40740064 missense possibly damaging 0.90
R5845:Mgam UTSW 6 40675323 missense possibly damaging 0.78
R5847:Mgam UTSW 6 40684055 missense probably benign 0.42
R5891:Mgam UTSW 6 40744348 missense probably benign
R6158:Mgam UTSW 6 40757714 missense probably damaging 1.00
R6193:Mgam UTSW 6 40747920 nonsense probably null
R6423:Mgam UTSW 6 40677045 missense possibly damaging 0.84
R6706:Mgam UTSW 6 40744786 missense probably benign 0.00
R6813:Mgam UTSW 6 40750165 missense probably damaging 0.99
R6863:Mgam UTSW 6 40729009 missense probably benign 0.00
R6906:Mgam UTSW 6 40747919 missense probably damaging 1.00
R7091:Mgam UTSW 6 40768276 missense possibly damaging 0.95
R7099:Mgam UTSW 6 40661716 missense probably benign 0.09
R7282:Mgam UTSW 6 40656512 missense possibly damaging 0.71
R7282:Mgam UTSW 6 40763111 missense probably benign
X0021:Mgam UTSW 6 40659047 missense probably damaging 1.00
Z1088:Mgam UTSW 6 40643060 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- ATCATTATCAAGGTTGAGGAGTGGG -3'
(R):5'- CCCTGTCCACACCTGATAGTAC -3'

Sequencing Primer
(F):5'- CTCCAGCAGAGCAGGGATTTAAATTC -3'
(R):5'- CATACCTTAAACTGCAGCATTTCG -3'
Posted On2016-03-01