Incidental Mutation 'R4826:Dip2b'
ID374165
Institutional Source Beutler Lab
Gene Symbol Dip2b
Ensembl Gene ENSMUSG00000023026
Gene Namedisco interacting protein 2 homolog B
Synonyms
MMRRC Submission 042442-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.484) question?
Stock #R4826 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location100038664-100219473 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 100169281 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Aspartic acid at position 555 (N555D)
Ref Sequence ENSEMBL: ENSMUSP00000104599 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023768] [ENSMUST00000100203] [ENSMUST00000108971]
Predicted Effect possibly damaging
Transcript: ENSMUST00000023768
AA Change: N321D

PolyPhen 2 Score 0.853 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000023768
Gene: ENSMUSG00000023026
AA Change: N321D

DomainStartEndE-ValueType
Pfam:AMP-binding 109 584 9.5e-26 PFAM
Pfam:AMP-binding 760 1235 1.2e-52 PFAM
low complexity region 1299 1311 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000100203
AA Change: N555D

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000097777
Gene: ENSMUSG00000023026
AA Change: N555D

DomainStartEndE-ValueType
DMAP_binding 12 130 1e-42 SMART
low complexity region 152 168 N/A INTRINSIC
low complexity region 181 192 N/A INTRINSIC
Pfam:AMP-binding 341 817 2e-26 PFAM
Pfam:AMP-binding 993 1468 1.8e-64 PFAM
low complexity region 1532 1544 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000108971
AA Change: N321D

PolyPhen 2 Score 0.853 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000104599
Gene: ENSMUSG00000023026
AA Change: N321D

DomainStartEndE-ValueType
Pfam:AMP-binding 108 583 9.5e-26 PFAM
Pfam:AMP-binding 759 1234 1.2e-52 PFAM
low complexity region 1298 1310 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230733
Meta Mutation Damage Score 0.31 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.0%
Validation Efficiency 100% (72/72)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the disco-interacting protein homolog 2 protein family. The encoded protein contains a binding site for the transcriptional regulator DNA methyltransferase 1 associated protein 1 as well as AMP-binding sites. The presence of these sites suggests that the encoded protein may participate in DNA methylation. This gene is located near a folate-sensitive fragile site, and CGG-repeat expansion in the promoter of this gene which affects transcription has been detected in individuals containing this fragile site on chromosome 12. [provided by RefSeq, Aug 2011]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110002H16Rik G T 18: 12,185,779 probably benign Het
Abca14 A T 7: 120,216,247 R239S probably damaging Het
Acin1 A G 14: 54,664,617 S573P probably damaging Het
Acta2 A T 19: 34,251,823 Y55* probably null Het
Aifm2 T C 10: 61,725,989 M38T probably benign Het
Ank2 C A 3: 126,956,001 V1331L possibly damaging Het
Ap1b1 T C 11: 5,018,043 S185P probably benign Het
Arsj A G 3: 126,438,802 Y399C probably damaging Het
Clec2d T C 6: 129,184,159 V73A probably benign Het
Cntln T G 4: 85,005,044 M582R probably benign Het
Cyp4a10 C T 4: 115,518,344 P8L probably benign Het
Dusp4 T A 8: 34,818,517 F311I probably damaging Het
Eif4g3 T C 4: 138,177,945 V1245A possibly damaging Het
Ephb3 G A 16: 21,214,995 R277H possibly damaging Het
Ext2 T C 2: 93,762,630 T410A probably benign Het
Fam193a A G 5: 34,436,531 E124G probably damaging Het
Fat4 T A 3: 38,982,957 V3586E probably damaging Het
Frmd4a T C 2: 4,601,297 S611P probably damaging Het
Gcn1l1 A G 5: 115,593,693 T956A probably benign Het
Gm10549 C A 18: 33,470,785 T107K unknown Het
Gm7102 C T 19: 61,175,926 G24R unknown Het
Herc6 T A 6: 57,647,087 M614K probably benign Het
Hspg2 T C 4: 137,565,395 C4095R probably damaging Het
Hyal5 T C 6: 24,891,576 I463T possibly damaging Het
Icam5 C T 9: 21,037,803 A817V possibly damaging Het
Igf2r A T 17: 12,701,353 D1366E probably damaging Het
Ints7 G A 1: 191,611,906 V553I probably damaging Het
Iqgap2 T A 13: 95,763,275 I92F probably damaging Het
Itgb1 T A 8: 128,720,308 C435S probably damaging Het
Lrrc71 T C 3: 87,743,308 M216V probably benign Het
Mgam T C 6: 40,680,648 V979A possibly damaging Het
Myh9 A T 15: 77,788,946 Y400* probably null Het
Narfl A G 17: 25,780,332 H240R probably damaging Het
Nbeal1 A G 1: 60,251,342 R1033G possibly damaging Het
Nit1 T C 1: 171,345,598 probably benign Het
Nlrp1c-ps A G 11: 71,242,517 noncoding transcript Het
Nt5c1a T C 4: 123,208,572 V97A probably damaging Het
Olfr1154 T A 2: 87,903,349 D109V probably damaging Het
Olfr358 A G 2: 37,005,333 Y94H probably damaging Het
Olfr43 A G 11: 74,206,331 M295T possibly damaging Het
Olfr46 T A 7: 140,610,319 M51K probably benign Het
Olfr683 G T 7: 105,143,968 N114K probably damaging Het
Pde4a T A 9: 21,192,380 probably null Het
Pkn2 T C 3: 142,809,509 K640R probably damaging Het
Pla2g6 A G 15: 79,308,679 S263P possibly damaging Het
Prkg1 A G 19: 31,764,606 S73P possibly damaging Het
Prr27 A C 5: 87,850,966 probably benign Het
Rad54b G T 4: 11,599,753 W319L probably damaging Het
Rassf8 T A 6: 145,816,550 L349H probably damaging Het
Rnf113a2 T A 12: 84,417,614 N93K probably benign Het
Sapcd2 C T 2: 25,372,756 A109V probably benign Het
Slamf9 C A 1: 172,476,441 H118N probably benign Het
Slc37a1 A G 17: 31,322,173 Y213C probably damaging Het
Slc5a1 A G 5: 33,159,150 D580G probably benign Het
Slc7a2 T A 8: 40,911,046 I432N probably damaging Het
Tas2r114 A T 6: 131,689,837 L76Q probably damaging Het
Tcerg1 C T 18: 42,535,115 P391L unknown Het
Tdrd12 A C 7: 35,504,157 V314G probably benign Het
Zbtb7b A G 3: 89,380,773 L246S probably benign Het
Other mutations in Dip2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00515:Dip2b APN 15 100174501 missense probably damaging 1.00
IGL01716:Dip2b APN 15 100209636 missense probably benign 0.00
IGL01893:Dip2b APN 15 100171220 unclassified probably benign
IGL01915:Dip2b APN 15 100178511 missense probably damaging 1.00
IGL02125:Dip2b APN 15 100186250 missense possibly damaging 0.60
IGL02200:Dip2b APN 15 100151202 missense possibly damaging 0.93
IGL02506:Dip2b APN 15 100157281 missense probably damaging 1.00
IGL02571:Dip2b APN 15 100157885 missense possibly damaging 0.93
IGL02706:Dip2b APN 15 100215311 missense probably damaging 0.98
IGL02983:Dip2b APN 15 100132022 missense possibly damaging 0.81
IGL03120:Dip2b APN 15 100203127 unclassified probably benign
IGL03181:Dip2b APN 15 100215207 missense probably damaging 0.98
IGL03229:Dip2b APN 15 100207838 unclassified probably benign
IGL03399:Dip2b APN 15 100175327 missense possibly damaging 0.63
PIT4131001:Dip2b UTSW 15 100202352 missense probably damaging 1.00
R0009:Dip2b UTSW 15 100169312 missense probably damaging 1.00
R0058:Dip2b UTSW 15 100215240 missense probably benign 0.03
R0058:Dip2b UTSW 15 100215240 missense probably benign 0.03
R0092:Dip2b UTSW 15 100202265 missense probably damaging 1.00
R0201:Dip2b UTSW 15 100186147 missense probably damaging 0.98
R0359:Dip2b UTSW 15 100211993 missense probably damaging 0.98
R0390:Dip2b UTSW 15 100193913 missense probably damaging 0.99
R0564:Dip2b UTSW 15 100162719 nonsense probably null
R0730:Dip2b UTSW 15 100171651 missense probably damaging 1.00
R1144:Dip2b UTSW 15 100154250 missense probably benign 0.11
R1200:Dip2b UTSW 15 100209745 missense probably benign 0.00
R1506:Dip2b UTSW 15 100183113 missense probably damaging 1.00
R1750:Dip2b UTSW 15 100178466 missense probably benign
R1760:Dip2b UTSW 15 100212029 missense probably damaging 1.00
R1773:Dip2b UTSW 15 100193961 missense probably benign 0.00
R1812:Dip2b UTSW 15 100198938 splice site probably null
R2264:Dip2b UTSW 15 100203216 missense probably benign 0.05
R3105:Dip2b UTSW 15 100142137 nonsense probably null
R4029:Dip2b UTSW 15 100186172 missense probably damaging 1.00
R4030:Dip2b UTSW 15 100186172 missense probably damaging 1.00
R4296:Dip2b UTSW 15 100181336 missense probably benign
R4392:Dip2b UTSW 15 100162036 missense probably damaging 1.00
R4480:Dip2b UTSW 15 100186301 missense probably damaging 0.99
R4564:Dip2b UTSW 15 100157258 nonsense probably null
R4605:Dip2b UTSW 15 100209636 missense probably benign 0.00
R4606:Dip2b UTSW 15 100215329 missense possibly damaging 0.91
R4634:Dip2b UTSW 15 100160491 missense probably damaging 1.00
R4667:Dip2b UTSW 15 100151360 missense probably benign 0.01
R4739:Dip2b UTSW 15 100207777 missense probably damaging 0.98
R4870:Dip2b UTSW 15 100195784 splice site probably null
R4877:Dip2b UTSW 15 100160529 missense possibly damaging 0.49
R4932:Dip2b UTSW 15 100171722 missense probably damaging 1.00
R5009:Dip2b UTSW 15 100195784 splice site probably null
R5169:Dip2b UTSW 15 100205113 missense probably damaging 1.00
R5216:Dip2b UTSW 15 100211986 missense probably damaging 1.00
R5218:Dip2b UTSW 15 100154296 missense probably benign 0.00
R5274:Dip2b UTSW 15 100212104 missense possibly damaging 0.54
R5370:Dip2b UTSW 15 100211986 missense probably damaging 1.00
R5420:Dip2b UTSW 15 100205173 intron probably benign
R5447:Dip2b UTSW 15 100211986 missense probably damaging 1.00
R5670:Dip2b UTSW 15 100190104 missense possibly damaging 0.80
R5768:Dip2b UTSW 15 100157945 missense probably benign 0.32
R5908:Dip2b UTSW 15 100151184 missense possibly damaging 0.93
R5957:Dip2b UTSW 15 100209694 missense probably benign 0.03
R5987:Dip2b UTSW 15 100190079 missense probably damaging 1.00
R6260:Dip2b UTSW 15 100162702 missense probably benign 0.05
R6325:Dip2b UTSW 15 100154282 missense probably benign 0.00
R6367:Dip2b UTSW 15 100115914 missense possibly damaging 0.50
R6391:Dip2b UTSW 15 100151276 missense probably damaging 1.00
R6422:Dip2b UTSW 15 100199011 missense probably damaging 0.98
X0064:Dip2b UTSW 15 100115850 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTGTTTCTTCTGTGACCGC -3'
(R):5'- GGGATATAGCCCTTCTCAGATG -3'

Sequencing Primer
(F):5'- TGACCGCATCACACTGTC -3'
(R):5'- AGGGTCTAAACTCAGGTCCTCATG -3'
Posted OnMar 01, 2016