Incidental Mutation 'R4824:Prr14l'
ID374202
Institutional Source Beutler Lab
Gene Symbol Prr14l
Ensembl Gene ENSMUSG00000054280
Gene Nameproline rich 14-like
Synonyms
MMRRC Submission 042440-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.191) question?
Stock #R4824 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location32789820-32854256 bp(-) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) T to C at 32844399 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000135589 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000120129] [ENSMUST00000130134]
Predicted Effect unknown
Transcript: ENSMUST00000120129
AA Change: E39G
SMART Domains Protein: ENSMUSP00000113259
Gene: ENSMUSG00000054280
AA Change: E39G

DomainStartEndE-ValueType
low complexity region 720 731 N/A INTRINSIC
low complexity region 1433 1446 N/A INTRINSIC
low complexity region 1471 1480 N/A INTRINSIC
Pfam:Tantalus 1838 1895 2.9e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000130134
Meta Mutation Damage Score 0.0948 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.0%
Validation Efficiency 98% (123/126)
Allele List at MGI
Other mutations in this stock
Total: 107 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik A G 3: 138,065,676 T209A probably benign Het
1700086D15Rik T C 11: 65,152,615 probably benign Het
4930452B06Rik A T 14: 8,665,997 M1K probably null Het
A130010J15Rik G A 1: 193,174,657 V106I probably benign Het
Abca16 C A 7: 120,475,479 N580K possibly damaging Het
Actrt2 A T 4: 154,666,887 F264Y probably damaging Het
Adh4 G A 3: 138,429,046 S327N possibly damaging Het
Alkbh5 T C 11: 60,553,871 probably null Het
Anapc1 T A 2: 128,628,690 T1507S possibly damaging Het
Anapc2 A G 2: 25,277,752 R444G probably damaging Het
Apoh G T 11: 108,414,261 W335L probably benign Het
B4galt7 A T 13: 55,604,349 H71L possibly damaging Het
Bicd2 A G 13: 49,379,012 E358G probably damaging Het
Bmper T A 9: 23,223,660 V7D possibly damaging Het
Brca2 T C 5: 150,539,735 F988S probably damaging Het
Brix1 A G 15: 10,485,742 V49A possibly damaging Het
Brpf3 T C 17: 28,806,486 S178P probably benign Het
Btaf1 A G 19: 36,981,048 Y655C possibly damaging Het
C1rl C G 6: 124,509,081 Y470* probably null Het
Cacnb4 A G 2: 52,675,810 V21A probably benign Het
Caskin1 C A 17: 24,501,129 P437T probably benign Het
Casz1 C A 4: 148,944,571 P1158T probably damaging Het
Ccdc141 T A 2: 77,124,336 Q189L probably damaging Het
Ccr3 T C 9: 124,028,772 V48A probably damaging Het
Cebpd G A 16: 15,888,114 G264S probably benign Het
Chd1 C A 17: 15,733,124 S440R probably damaging Het
Clip1 T A 5: 123,631,023 E504D probably damaging Het
Cmya5 T C 13: 93,093,574 R1669G probably benign Het
Col11a2 T A 17: 34,050,963 F456I probably damaging Het
Col4a3bp C T 13: 96,616,487 P350S probably benign Het
Ctnna2 A T 6: 76,980,781 M130K probably damaging Het
Elmo2 A T 2: 165,292,002 probably benign Het
F11 T C 8: 45,255,342 D27G probably damaging Het
Faap100 A T 11: 120,375,586 probably null Het
Fat1 A G 8: 44,989,114 E1151G probably damaging Het
Fbll1 T A 11: 35,797,825 I204F probably damaging Het
Gle1 T A 2: 29,940,203 V257D possibly damaging Het
Hoxc9 T A 15: 102,981,793 C47* probably null Het
Hsd17b6 A G 10: 127,993,655 V226A probably benign Het
Hsd17b7 C T 1: 169,961,195 R151Q probably benign Het
Hsh2d G A 8: 72,200,460 D229N probably benign Het
Ido2 A G 8: 24,533,859 I321T probably benign Het
Irf2bp2 T C 8: 126,591,433 T465A probably benign Het
Kdm2a A G 19: 4,362,787 M34T probably damaging Het
Klhl6 C T 16: 19,957,028 R260H probably damaging Het
Kntc1 T A 5: 123,790,133 L1231* probably null Het
Lca5l A C 16: 96,162,029 Y412* probably null Het
Lipt1 T C 1: 37,875,432 S190P possibly damaging Het
Ly6f T A 15: 75,271,720 V92D probably damaging Het
Matn4 T A 2: 164,393,231 M433L probably benign Het
Mbtd1 C A 11: 93,925,702 P370T probably benign Het
Mcph1 T A 8: 18,632,687 probably null Het
Muc5b T A 7: 141,864,185 C3623S probably damaging Het
Myt1l C A 12: 29,849,400 H134N probably benign Het
Nav2 A T 7: 49,409,001 probably benign Het
Ndufaf8 T C 11: 120,099,166 C35R probably damaging Het
Neb G A 2: 52,204,879 T5130I possibly damaging Het
Nlrp9c T C 7: 26,380,564 N624S possibly damaging Het
Nr0b2 C A 4: 133,556,023 H190Q probably damaging Het
Nrg4 A G 9: 55,249,121 probably benign Het
Nup88 A T 11: 70,961,624 V215E probably benign Het
Oas2 T G 5: 120,738,346 T511P probably benign Het
Olfr1151 T C 2: 87,857,277 V34A probably benign Het
Olfr1162 A C 2: 88,050,088 F179V probably damaging Het
Olfr1500 A C 19: 13,828,354 L14R probably damaging Het
Olfr384 A G 11: 73,602,600 T7A possibly damaging Het
Olfr720 A G 14: 14,175,885 S66P probably damaging Het
Olfr943 A G 9: 39,184,205 N9S probably benign Het
Pcdhgb2 T A 18: 37,690,449 N164K probably damaging Het
Pde4d C G 13: 109,116,866 P76A probably benign Het
Phlda1 T C 10: 111,507,655 probably benign Het
Plekhh1 A G 12: 79,054,803 T216A probably benign Het
Plppr3 T A 10: 79,865,673 E445V possibly damaging Het
Prom1 A G 5: 44,034,390 V337A probably damaging Het
Psmd1 A G 1: 86,137,098 I951V probably benign Het
Rab35 T G 5: 115,643,395 I85M possibly damaging Het
Rad9a A T 19: 4,200,537 S93T probably benign Het
Ric1 G A 19: 29,585,842 C555Y probably damaging Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Ror2 T A 13: 53,110,683 Q791L probably benign Het
Rps8 G C 4: 117,155,155 probably benign Het
Sdr16c5 C T 4: 4,016,216 W70* probably null Het
Senp3 A G 11: 69,677,995 V408A probably benign Het
Sh2d4b C A 14: 40,840,344 W288L probably benign Het
Slc38a9 A T 13: 112,723,298 D422V probably damaging Het
Slc4a2 T C 5: 24,440,143 F1104L probably damaging Het
Slc4a3 A G 1: 75,550,623 K113E possibly damaging Het
Spata3 G A 1: 86,024,326 probably null Het
Spata31d1d A T 13: 59,729,241 V160E possibly damaging Het
Sprr2f A G 3: 92,365,896 M1V probably null Het
Sptbn1 A G 11: 30,118,295 V1733A possibly damaging Het
Syce1 C A 7: 140,779,896 L83F probably damaging Het
Tardbp A G 4: 148,617,593 I295T probably benign Het
Tmem212 A G 3: 27,885,008 S110P probably damaging Het
Tnc G A 4: 64,017,620 Q360* probably null Het
Tnrc6c C A 11: 117,722,905 Q630K probably damaging Het
Ttc19 G A 11: 62,309,096 R235H probably benign Het
Ube3b T A 5: 114,415,726 probably null Het
Vmn2r31 C T 7: 7,387,063 probably null Het
Vmn2r92 T A 17: 18,151,921 probably benign Het
Washc5 A T 15: 59,333,636 Y685* probably null Het
Wdr93 T A 7: 79,750,069 Y135* probably null Het
Wdr95 T A 5: 149,595,332 I546K probably damaging Het
Zbtb38 T A 9: 96,688,201 T277S probably benign Het
Zfp13 T C 17: 23,576,823 D258G possibly damaging Het
Zfp397 T A 18: 23,960,192 S245T probably benign Het
Zfp646 T C 7: 127,883,735 Y1695H probably benign Het
Other mutations in Prr14l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00229:Prr14l APN 5 32830676 missense probably benign 0.04
IGL00331:Prr14l APN 5 32831066 missense probably benign 0.02
IGL01571:Prr14l APN 5 32828806 missense probably benign 0.01
IGL01795:Prr14l APN 5 32831845 unclassified probably benign
IGL01929:Prr14l APN 5 32828243 missense probably benign 0.09
IGL01959:Prr14l APN 5 32830205 missense possibly damaging 0.84
IGL02139:Prr14l APN 5 32827532 missense probably damaging 1.00
IGL02321:Prr14l APN 5 32827807 missense probably benign 0.10
IGL02508:Prr14l APN 5 32830942 missense probably benign 0.01
IGL02551:Prr14l APN 5 32831484 missense probably damaging 1.00
IGL02585:Prr14l APN 5 32829484 missense possibly damaging 0.59
IGL02614:Prr14l APN 5 32830543 missense possibly damaging 0.76
IGL02808:Prr14l APN 5 32828182 missense possibly damaging 0.94
IGL02836:Prr14l APN 5 32831096 missense probably benign 0.42
IGL02952:Prr14l APN 5 32835670 missense unknown
IGL03034:Prr14l APN 5 32827438 missense possibly damaging 0.48
H8562:Prr14l UTSW 5 32793728 missense probably damaging 1.00
R0086:Prr14l UTSW 5 32831559 unclassified probably benign
R0149:Prr14l UTSW 5 32793641 missense probably damaging 1.00
R0333:Prr14l UTSW 5 32827993 missense probably damaging 1.00
R0361:Prr14l UTSW 5 32793641 missense probably damaging 1.00
R0416:Prr14l UTSW 5 32828717 missense probably benign 0.25
R0480:Prr14l UTSW 5 32829880 missense probably benign 0.02
R0511:Prr14l UTSW 5 32844216 intron probably benign
R0639:Prr14l UTSW 5 32828915 missense probably benign 0.02
R0673:Prr14l UTSW 5 32828915 missense probably benign 0.02
R0743:Prr14l UTSW 5 32831194 missense possibly damaging 0.55
R0792:Prr14l UTSW 5 32828423 missense probably damaging 1.00
R1006:Prr14l UTSW 5 32829482 missense probably benign 0.00
R1342:Prr14l UTSW 5 32830260 missense probably damaging 1.00
R1433:Prr14l UTSW 5 32828833 missense probably damaging 1.00
R1527:Prr14l UTSW 5 32827949 missense possibly damaging 0.75
R1704:Prr14l UTSW 5 32830282 missense probably benign 0.01
R1967:Prr14l UTSW 5 32844469 intron probably benign
R2129:Prr14l UTSW 5 32831828 unclassified probably benign
R2150:Prr14l UTSW 5 32830702 missense probably benign 0.14
R2318:Prr14l UTSW 5 32830078 missense probably benign 0.04
R2915:Prr14l UTSW 5 32829768 missense probably benign 0.04
R3551:Prr14l UTSW 5 32828619 unclassified probably null
R3820:Prr14l UTSW 5 32828984 missense probably damaging 0.99
R3852:Prr14l UTSW 5 32830345 missense probably damaging 1.00
R4126:Prr14l UTSW 5 32828003 missense probably damaging 0.97
R4345:Prr14l UTSW 5 32828576 missense probably damaging 1.00
R4388:Prr14l UTSW 5 32829254 missense probably damaging 1.00
R4575:Prr14l UTSW 5 32793644 missense probably damaging 1.00
R4596:Prr14l UTSW 5 32829308 missense probably benign 0.01
R4690:Prr14l UTSW 5 32844156 intron probably benign
R4868:Prr14l UTSW 5 32829937 missense probably benign 0.04
R4869:Prr14l UTSW 5 32828833 missense probably damaging 1.00
R5201:Prr14l UTSW 5 32830247 missense possibly damaging 0.52
R5328:Prr14l UTSW 5 32830021 missense probably benign 0.00
R5410:Prr14l UTSW 5 32827777 missense probably damaging 0.98
R5476:Prr14l UTSW 5 32844138 intron probably benign
R5623:Prr14l UTSW 5 32844508 intron probably benign
R5730:Prr14l UTSW 5 32793603 missense probably damaging 1.00
R5988:Prr14l UTSW 5 32830851 missense probably damaging 0.98
R6261:Prr14l UTSW 5 32829404 missense possibly damaging 0.46
R6283:Prr14l UTSW 5 32830264 missense probably benign 0.14
R6307:Prr14l UTSW 5 32827525 missense probably damaging 0.97
R6825:Prr14l UTSW 5 32828548 missense possibly damaging 0.86
R6862:Prr14l UTSW 5 32827759 missense probably damaging 1.00
R6880:Prr14l UTSW 5 32830867 missense probably benign 0.01
R6931:Prr14l UTSW 5 32830691 missense probably damaging 0.98
R7101:Prr14l UTSW 5 32829427 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGACCTTTGGCTCCATGC -3'
(R):5'- GTCAGGGTAAACCATTGATGC -3'

Sequencing Primer
(F):5'- AGCCATAGGATCTCTTGTAGGATCC -3'
(R):5'- CCATTGATGCAAAAGACTTGACTC -3'
Posted On2016-03-01