Incidental Mutation 'R4824:Cmya5'
ID374256
Institutional Source Beutler Lab
Gene Symbol Cmya5
Ensembl Gene ENSMUSG00000047419
Gene Namecardiomyopathy associated 5
SynonymsMyospryn, 2310076E21Rik, 2310076E16Rik
MMRRC Submission 042440-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.215) question?
Stock #R4824 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location93040713-93144724 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 93093574 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glycine at position 1669 (R1669G)
Ref Sequence ENSEMBL: ENSMUSP00000050408 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062122]
Predicted Effect probably benign
Transcript: ENSMUST00000062122
AA Change: R1669G

PolyPhen 2 Score 0.035 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000050408
Gene: ENSMUSG00000047419
AA Change: R1669G

DomainStartEndE-ValueType
low complexity region 20 46 N/A INTRINSIC
low complexity region 129 140 N/A INTRINSIC
internal_repeat_1 448 535 5.09e-18 PROSPERO
internal_repeat_1 543 625 5.09e-18 PROSPERO
low complexity region 626 645 N/A INTRINSIC
low complexity region 679 691 N/A INTRINSIC
low complexity region 734 741 N/A INTRINSIC
low complexity region 1001 1010 N/A INTRINSIC
low complexity region 1166 1183 N/A INTRINSIC
low complexity region 1259 1267 N/A INTRINSIC
low complexity region 1440 1449 N/A INTRINSIC
low complexity region 1876 1889 N/A INTRINSIC
low complexity region 2632 2645 N/A INTRINSIC
low complexity region 3048 3057 N/A INTRINSIC
FN3 3312 3399 7.29e-4 SMART
FN3 3411 3492 1.3e0 SMART
Pfam:SPRY 3551 3668 6.7e-8 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224009
Meta Mutation Damage Score 0.12 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.0%
Validation Efficiency 98% (123/126)
Allele List at MGI
Other mutations in this stock
Total: 107 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik A G 3: 138,065,676 T209A probably benign Het
1700086D15Rik T C 11: 65,152,615 probably benign Het
4930452B06Rik A T 14: 8,665,997 M1K probably null Het
A130010J15Rik G A 1: 193,174,657 V106I probably benign Het
Abca16 C A 7: 120,475,479 N580K possibly damaging Het
Actrt2 A T 4: 154,666,887 F264Y probably damaging Het
Adh4 G A 3: 138,429,046 S327N possibly damaging Het
Alkbh5 T C 11: 60,553,871 probably null Het
Anapc1 T A 2: 128,628,690 T1507S possibly damaging Het
Anapc2 A G 2: 25,277,752 R444G probably damaging Het
Apoh G T 11: 108,414,261 W335L probably benign Het
B4galt7 A T 13: 55,604,349 H71L possibly damaging Het
Bicd2 A G 13: 49,379,012 E358G probably damaging Het
Bmper T A 9: 23,223,660 V7D possibly damaging Het
Brca2 T C 5: 150,539,735 F988S probably damaging Het
Brix1 A G 15: 10,485,742 V49A possibly damaging Het
Brpf3 T C 17: 28,806,486 S178P probably benign Het
Btaf1 A G 19: 36,981,048 Y655C possibly damaging Het
C1rl C G 6: 124,509,081 Y470* probably null Het
Cacnb4 A G 2: 52,675,810 V21A probably benign Het
Caskin1 C A 17: 24,501,129 P437T probably benign Het
Casz1 C A 4: 148,944,571 P1158T probably damaging Het
Ccdc141 T A 2: 77,124,336 Q189L probably damaging Het
Ccr3 T C 9: 124,028,772 V48A probably damaging Het
Cebpd G A 16: 15,888,114 G264S probably benign Het
Chd1 C A 17: 15,733,124 S440R probably damaging Het
Clip1 T A 5: 123,631,023 E504D probably damaging Het
Col11a2 T A 17: 34,050,963 F456I probably damaging Het
Col4a3bp C T 13: 96,616,487 P350S probably benign Het
Ctnna2 A T 6: 76,980,781 M130K probably damaging Het
Elmo2 A T 2: 165,292,002 probably benign Het
F11 T C 8: 45,255,342 D27G probably damaging Het
Faap100 A T 11: 120,375,586 probably null Het
Fat1 A G 8: 44,989,114 E1151G probably damaging Het
Fbll1 T A 11: 35,797,825 I204F probably damaging Het
Gle1 T A 2: 29,940,203 V257D possibly damaging Het
Hoxc9 T A 15: 102,981,793 C47* probably null Het
Hsd17b6 A G 10: 127,993,655 V226A probably benign Het
Hsd17b7 C T 1: 169,961,195 R151Q probably benign Het
Hsh2d G A 8: 72,200,460 D229N probably benign Het
Ido2 A G 8: 24,533,859 I321T probably benign Het
Irf2bp2 T C 8: 126,591,433 T465A probably benign Het
Kdm2a A G 19: 4,362,787 M34T probably damaging Het
Klhl6 C T 16: 19,957,028 R260H probably damaging Het
Kntc1 T A 5: 123,790,133 L1231* probably null Het
Lca5l A C 16: 96,162,029 Y412* probably null Het
Lipt1 T C 1: 37,875,432 S190P possibly damaging Het
Ly6f T A 15: 75,271,720 V92D probably damaging Het
Matn4 T A 2: 164,393,231 M433L probably benign Het
Mbtd1 C A 11: 93,925,702 P370T probably benign Het
Mcph1 T A 8: 18,632,687 probably null Het
Muc5b T A 7: 141,864,185 C3623S probably damaging Het
Myt1l C A 12: 29,849,400 H134N probably benign Het
Nav2 A T 7: 49,409,001 probably benign Het
Ndufaf8 T C 11: 120,099,166 C35R probably damaging Het
Neb G A 2: 52,204,879 T5130I possibly damaging Het
Nlrp9c T C 7: 26,380,564 N624S possibly damaging Het
Nr0b2 C A 4: 133,556,023 H190Q probably damaging Het
Nrg4 A G 9: 55,249,121 probably benign Het
Nup88 A T 11: 70,961,624 V215E probably benign Het
Oas2 T G 5: 120,738,346 T511P probably benign Het
Olfr1151 T C 2: 87,857,277 V34A probably benign Het
Olfr1162 A C 2: 88,050,088 F179V probably damaging Het
Olfr1500 A C 19: 13,828,354 L14R probably damaging Het
Olfr384 A G 11: 73,602,600 T7A possibly damaging Het
Olfr720 A G 14: 14,175,885 S66P probably damaging Het
Olfr943 A G 9: 39,184,205 N9S probably benign Het
Pcdhgb2 T A 18: 37,690,449 N164K probably damaging Het
Pde4d C G 13: 109,116,866 P76A probably benign Het
Phlda1 T C 10: 111,507,655 probably benign Het
Plekhh1 A G 12: 79,054,803 T216A probably benign Het
Plppr3 T A 10: 79,865,673 E445V possibly damaging Het
Prom1 A G 5: 44,034,390 V337A probably damaging Het
Prr14l T C 5: 32,844,399 probably benign Het
Psmd1 A G 1: 86,137,098 I951V probably benign Het
Rab35 T G 5: 115,643,395 I85M possibly damaging Het
Rad9a A T 19: 4,200,537 S93T probably benign Het
Ric1 G A 19: 29,585,842 C555Y probably damaging Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Ror2 T A 13: 53,110,683 Q791L probably benign Het
Rps8 G C 4: 117,155,155 probably benign Het
Sdr16c5 C T 4: 4,016,216 W70* probably null Het
Senp3 A G 11: 69,677,995 V408A probably benign Het
Sh2d4b C A 14: 40,840,344 W288L probably benign Het
Slc38a9 A T 13: 112,723,298 D422V probably damaging Het
Slc4a2 T C 5: 24,440,143 F1104L probably damaging Het
Slc4a3 A G 1: 75,550,623 K113E possibly damaging Het
Spata3 G A 1: 86,024,326 probably null Het
Spata31d1d A T 13: 59,729,241 V160E possibly damaging Het
Sprr2f A G 3: 92,365,896 M1V probably null Het
Sptbn1 A G 11: 30,118,295 V1733A possibly damaging Het
Syce1 C A 7: 140,779,896 L83F probably damaging Het
Tardbp A G 4: 148,617,593 I295T probably benign Het
Tmem212 A G 3: 27,885,008 S110P probably damaging Het
Tnc G A 4: 64,017,620 Q360* probably null Het
Tnrc6c C A 11: 117,722,905 Q630K probably damaging Het
Ttc19 G A 11: 62,309,096 R235H probably benign Het
Ube3b T A 5: 114,415,726 probably null Het
Vmn2r31 C T 7: 7,387,063 probably null Het
Vmn2r92 T A 17: 18,151,921 probably benign Het
Washc5 A T 15: 59,333,636 Y685* probably null Het
Wdr93 T A 7: 79,750,069 Y135* probably null Het
Wdr95 T A 5: 149,595,332 I546K probably damaging Het
Zbtb38 T A 9: 96,688,201 T277S probably benign Het
Zfp13 T C 17: 23,576,823 D258G possibly damaging Het
Zfp397 T A 18: 23,960,192 S245T probably benign Het
Zfp646 T C 7: 127,883,735 Y1695H probably benign Het
Other mutations in Cmya5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00489:Cmya5 APN 13 93093120 missense probably benign 0.13
IGL00516:Cmya5 APN 13 93098167 missense possibly damaging 0.73
IGL00654:Cmya5 APN 13 93094161 missense probably benign 0.00
IGL00948:Cmya5 APN 13 93091036 missense probably benign
IGL00966:Cmya5 APN 13 93097906 missense probably benign 0.33
IGL00988:Cmya5 APN 13 93097933 missense possibly damaging 0.96
IGL01106:Cmya5 APN 13 93084612 missense probably damaging 1.00
IGL01331:Cmya5 APN 13 93096946 missense possibly damaging 0.53
IGL01392:Cmya5 APN 13 93089206 missense probably damaging 0.99
IGL01508:Cmya5 APN 13 93094027 missense probably benign
IGL01679:Cmya5 APN 13 93065320 missense probably damaging 1.00
IGL01749:Cmya5 APN 13 93089299 missense probably benign 0.00
IGL01861:Cmya5 APN 13 93089748 missense probably damaging 1.00
IGL02021:Cmya5 APN 13 93094549 missense probably benign 0.00
IGL02034:Cmya5 APN 13 93084535 splice site probably benign
IGL02103:Cmya5 APN 13 93092127 missense probably benign 0.05
IGL02174:Cmya5 APN 13 93048907 missense possibly damaging 0.76
IGL02176:Cmya5 APN 13 93090150 missense probably damaging 1.00
IGL02210:Cmya5 APN 13 93092734 missense probably benign 0.14
IGL02229:Cmya5 APN 13 93092686 missense possibly damaging 0.54
IGL02306:Cmya5 APN 13 93098019 missense probably damaging 1.00
IGL02311:Cmya5 APN 13 93090655 missense probably benign 0.40
IGL02409:Cmya5 APN 13 93090198 missense probably damaging 0.96
IGL02561:Cmya5 APN 13 93091858 missense probably benign 0.00
IGL02676:Cmya5 APN 13 93092853 missense probably damaging 1.00
IGL02683:Cmya5 APN 13 93090997 nonsense probably null
IGL02685:Cmya5 APN 13 93090997 nonsense probably null
IGL02686:Cmya5 APN 13 93090997 nonsense probably null
IGL02724:Cmya5 APN 13 93096655 missense probably benign
IGL02727:Cmya5 APN 13 93098245 missense possibly damaging 0.73
IGL02965:Cmya5 APN 13 93092557 missense probably benign 0.41
IGL03079:Cmya5 APN 13 93097701 missense possibly damaging 0.85
IGL03144:Cmya5 APN 13 93090868 missense probably damaging 1.00
IGL03253:Cmya5 APN 13 93091270 nonsense probably null
IGL03336:Cmya5 APN 13 93093505 missense possibly damaging 0.84
IGL03138:Cmya5 UTSW 13 93065342 missense probably damaging 1.00
P0023:Cmya5 UTSW 13 93089346 missense probably benign 0.22
P4748:Cmya5 UTSW 13 93074475 splice site probably benign
R0123:Cmya5 UTSW 13 93095904 missense possibly damaging 0.84
R0206:Cmya5 UTSW 13 93095557 missense probably damaging 0.98
R0206:Cmya5 UTSW 13 93095557 missense probably damaging 0.98
R0242:Cmya5 UTSW 13 93095600 missense probably benign
R0242:Cmya5 UTSW 13 93095600 missense probably benign
R0331:Cmya5 UTSW 13 93144403 missense possibly damaging 0.53
R0363:Cmya5 UTSW 13 93094869 missense possibly damaging 0.77
R0382:Cmya5 UTSW 13 93092748 missense probably benign 0.06
R0416:Cmya5 UTSW 13 93089856 missense probably benign 0.05
R0446:Cmya5 UTSW 13 93093656 missense probably benign
R0457:Cmya5 UTSW 13 93095587 missense possibly damaging 0.84
R0673:Cmya5 UTSW 13 93089997 missense probably damaging 1.00
R0674:Cmya5 UTSW 13 93092791 missense probably damaging 1.00
R0692:Cmya5 UTSW 13 93093849 nonsense probably null
R0698:Cmya5 UTSW 13 93095557 missense probably damaging 0.98
R1227:Cmya5 UTSW 13 93094446 missense probably damaging 0.99
R1272:Cmya5 UTSW 13 93095112 missense possibly damaging 0.79
R1335:Cmya5 UTSW 13 93041535 missense possibly damaging 0.65
R1353:Cmya5 UTSW 13 93041525 missense probably damaging 1.00
R1354:Cmya5 UTSW 13 93092058 missense possibly damaging 0.46
R1458:Cmya5 UTSW 13 93065327 missense probably benign 0.44
R1572:Cmya5 UTSW 13 93094269 missense possibly damaging 0.61
R1698:Cmya5 UTSW 13 93063519 missense probably benign 0.27
R1735:Cmya5 UTSW 13 93089789 missense probably benign 0.11
R1743:Cmya5 UTSW 13 93097317 missense probably benign 0.33
R1750:Cmya5 UTSW 13 93095663 missense probably benign
R1827:Cmya5 UTSW 13 93074448 missense possibly damaging 0.80
R2068:Cmya5 UTSW 13 93090524 missense possibly damaging 0.93
R2088:Cmya5 UTSW 13 93092812 missense probably damaging 1.00
R2132:Cmya5 UTSW 13 93069383 missense probably damaging 1.00
R2216:Cmya5 UTSW 13 93093495 missense probably damaging 1.00
R2363:Cmya5 UTSW 13 93093702 missense probably benign 0.15
R2497:Cmya5 UTSW 13 93098005 missense possibly damaging 0.53
R2509:Cmya5 UTSW 13 93093558 missense probably benign 0.41
R2917:Cmya5 UTSW 13 93091064 nonsense probably null
R2944:Cmya5 UTSW 13 93092842 nonsense probably null
R3039:Cmya5 UTSW 13 93092250 missense probably benign 0.12
R3078:Cmya5 UTSW 13 93048927 missense probably damaging 0.99
R3708:Cmya5 UTSW 13 93095366 nonsense probably null
R3717:Cmya5 UTSW 13 93092487 missense probably benign 0.12
R3768:Cmya5 UTSW 13 93096693 missense possibly damaging 0.73
R3769:Cmya5 UTSW 13 93096693 missense possibly damaging 0.73
R3840:Cmya5 UTSW 13 93094632 missense probably damaging 0.96
R3841:Cmya5 UTSW 13 93094632 missense probably damaging 0.96
R3882:Cmya5 UTSW 13 93091219 missense probably benign 0.07
R3888:Cmya5 UTSW 13 93093656 missense probably benign
R3897:Cmya5 UTSW 13 93096681 missense possibly damaging 0.72
R3952:Cmya5 UTSW 13 93089199 missense possibly damaging 0.89
R4366:Cmya5 UTSW 13 93091956 missense probably benign 0.36
R4471:Cmya5 UTSW 13 93092325 missense probably benign 0.01
R4493:Cmya5 UTSW 13 93094065 missense probably benign
R4495:Cmya5 UTSW 13 93094065 missense probably benign
R4544:Cmya5 UTSW 13 93091918 nonsense probably null
R4545:Cmya5 UTSW 13 93091918 nonsense probably null
R4624:Cmya5 UTSW 13 93063551 missense probably damaging 1.00
R4648:Cmya5 UTSW 13 93093828 missense possibly damaging 0.84
R4965:Cmya5 UTSW 13 93095787 missense possibly damaging 0.84
R4967:Cmya5 UTSW 13 93090585 missense probably damaging 1.00
R5101:Cmya5 UTSW 13 93091603 missense possibly damaging 0.61
R5133:Cmya5 UTSW 13 93093372 missense possibly damaging 0.79
R5139:Cmya5 UTSW 13 93096061 missense probably benign 0.00
R5220:Cmya5 UTSW 13 93092296 missense probably damaging 0.99
R5332:Cmya5 UTSW 13 93096195 missense probably damaging 0.96
R5337:Cmya5 UTSW 13 93083273 missense probably benign 0.28
R5356:Cmya5 UTSW 13 93063485 missense probably damaging 1.00
R5401:Cmya5 UTSW 13 93091968 missense probably damaging 1.00
R5438:Cmya5 UTSW 13 93095199 missense possibly damaging 0.89
R5604:Cmya5 UTSW 13 93092763 missense probably benign 0.15
R5628:Cmya5 UTSW 13 93089710 missense probably damaging 1.00
R5666:Cmya5 UTSW 13 93045949 missense possibly damaging 0.75
R5687:Cmya5 UTSW 13 93098176 missense possibly damaging 0.53
R5695:Cmya5 UTSW 13 93045866 critical splice donor site probably null
R5806:Cmya5 UTSW 13 93093937 missense possibly damaging 0.84
R5820:Cmya5 UTSW 13 93092780 missense probably benign 0.04
R5872:Cmya5 UTSW 13 93097435 missense probably benign 0.01
R5875:Cmya5 UTSW 13 93095184 missense probably benign 0.13
R5896:Cmya5 UTSW 13 93045865 critical splice donor site probably null
R5910:Cmya5 UTSW 13 93092643 missense probably damaging 0.98
R5969:Cmya5 UTSW 13 93089544 missense possibly damaging 0.78
R6064:Cmya5 UTSW 13 93089649 missense probably damaging 1.00
R6081:Cmya5 UTSW 13 93144513 unclassified probably benign
R6102:Cmya5 UTSW 13 93094231 missense probably benign
R6117:Cmya5 UTSW 13 93095166 missense probably damaging 0.98
R6188:Cmya5 UTSW 13 93093444 missense possibly damaging 0.61
R6188:Cmya5 UTSW 13 93097276 missense possibly damaging 0.73
R6219:Cmya5 UTSW 13 93094443 missense probably damaging 1.00
R6229:Cmya5 UTSW 13 93093306 missense probably benign 0.41
R6346:Cmya5 UTSW 13 93092190 missense probably damaging 1.00
R6431:Cmya5 UTSW 13 93074464 missense possibly damaging 0.60
R6436:Cmya5 UTSW 13 93089215 missense probably damaging 0.98
R6598:Cmya5 UTSW 13 93089808 missense probably benign 0.05
R6649:Cmya5 UTSW 13 93098025 missense possibly damaging 0.91
R6652:Cmya5 UTSW 13 93092895 missense probably benign 0.04
R6652:Cmya5 UTSW 13 93093039 missense probably damaging 0.99
R6669:Cmya5 UTSW 13 93093259 missense probably benign 0.03
R6881:Cmya5 UTSW 13 93090292 missense probably damaging 1.00
R6909:Cmya5 UTSW 13 93091252 missense probably benign 0.04
R6933:Cmya5 UTSW 13 93095136 missense probably benign 0.03
R7021:Cmya5 UTSW 13 93093555 missense possibly damaging 0.62
R7022:Cmya5 UTSW 13 93069278 critical splice donor site probably null
R7068:Cmya5 UTSW 13 93092697 missense possibly damaging 0.59
R7087:Cmya5 UTSW 13 93090975 missense not run
R7088:Cmya5 UTSW 13 93091864 missense not run
R7126:Cmya5 UTSW 13 93089940 missense not run
X0028:Cmya5 UTSW 13 93096687 missense possibly damaging 0.53
Z1088:Cmya5 UTSW 13 93063579 missense probably benign
Predicted Primers PCR Primer
(F):5'- TGGCTTATCTGCAGAAGAGC -3'
(R):5'- GGCAAGCAGAGGAGACATCTTC -3'

Sequencing Primer
(F):5'- CAGAAGAGCTGCTCTCATCAGG -3'
(R):5'- GAGACATCTTCTCCAGTGCCG -3'
Posted On2016-03-01