Incidental Mutation 'R4861:Lctl'
ID 374298
Institutional Source Beutler Lab
Gene Symbol Lctl
Ensembl Gene ENSMUSG00000032401
Gene Name lactase-like
Synonyms KLPH, E130104I05Rik
MMRRC Submission 042472-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.096) question?
Stock # R4861 (G1)
Quality Score 225
Status Not validated
Chromosome 9
Chromosomal Location 64024429-64045400 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 64027045 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Threonine at position 131 (I131T)
Ref Sequence ENSEMBL: ENSMUSP00000120815 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034969] [ENSMUST00000118215] [ENSMUST00000124020]
AlphaFold Q8K1F9
Predicted Effect probably benign
Transcript: ENSMUST00000034969
AA Change: I131T

PolyPhen 2 Score 0.229 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000034969
Gene: ENSMUSG00000032401
AA Change: I131T

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:Glyco_hydro_1 32 502 1.7e-161 PFAM
transmembrane domain 540 562 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000118215
SMART Domains Protein: ENSMUSP00000112979
Gene: ENSMUSG00000032401

DomainStartEndE-ValueType
Pfam:Glyco_hydro_1 1 343 5.8e-99 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000124020
AA Change: I131T

PolyPhen 2 Score 0.552 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000120815
Gene: ENSMUSG00000032401
AA Change: I131T

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:Glyco_hydro_1 32 235 2.3e-84 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132018
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139755
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145011
Meta Mutation Damage Score 0.7978 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 95.1%
  • 20x: 87.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of family 1 glycosidases. Glycosidases are enzymes that hydrolyze glycosidic bonds and are classified into families based on primary amino acid sequence. Most members of family 1 have two conserved glutamic acid residues, which are required for enzymatic activity. The mouse ortholog of this protein has been characterized and has a domain structure of an N-terminal signal peptide, glycosidase domain, transmembrane domain, and a short cytoplasmic tail. It lacks one of the conserved glutamic acid residues important for catalysis, and its function remains to be determined (PMID: 12084582). Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jun 2013]
PHENOTYPE: No notable phenotype was detected in a high-throughput screen of homozygous null mice. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb11 C T 2: 69,076,249 (GRCm39) R1153H probably damaging Het
Ahcy T C 2: 154,902,436 (GRCm39) E411G probably benign Het
Alpi T A 1: 87,028,191 (GRCm39) I211F probably damaging Het
Arfgef3 G A 10: 18,483,479 (GRCm39) A1415V probably benign Het
Bora T C 14: 99,284,910 (GRCm39) probably null Het
Car3 T C 3: 14,931,956 (GRCm39) V109A probably damaging Het
Cdk13 A T 13: 17,941,171 (GRCm39) V17D probably damaging Het
Cept1 A C 3: 106,413,048 (GRCm39) S226A probably damaging Het
Dbt A T 3: 116,341,727 (GRCm39) I443L probably benign Het
Dnase1l1 C T X: 73,320,644 (GRCm39) probably null Het
Dync1h1 C A 12: 110,624,560 (GRCm39) T3700N probably damaging Het
Farp2 T C 1: 93,533,141 (GRCm39) L633S probably damaging Het
Gm26727 T C 2: 67,263,289 (GRCm39) I79M probably damaging Het
Gm5800 T A 14: 51,953,504 (GRCm39) N37I probably damaging Het
Hapln1 G A 13: 89,749,571 (GRCm39) G39S possibly damaging Het
Ice2 T A 9: 69,322,730 (GRCm39) S408R probably benign Het
Ncoa7 T A 10: 30,580,608 (GRCm39) M117L probably benign Het
Npy4r C T 14: 33,868,840 (GRCm39) W149* probably null Het
Nr5a2 A G 1: 136,876,458 (GRCm39) probably null Het
Odad1 A G 7: 45,592,297 (GRCm39) E359G probably damaging Het
Plg G A 17: 12,614,622 (GRCm39) E301K probably benign Het
Pnkp C T 7: 44,511,827 (GRCm39) S113L probably damaging Het
Rapgef2 T C 3: 78,981,743 (GRCm39) K1084R probably benign Het
Slc41a2 T C 10: 83,152,322 (GRCm39) Q51R probably damaging Het
Slc47a2 A T 11: 61,227,059 (GRCm39) C170S probably benign Het
Slco1b2 A T 6: 141,616,948 (GRCm39) N427I possibly damaging Het
Smc2 G A 4: 52,461,090 (GRCm39) R571H probably benign Het
Sp4 G T 12: 118,264,546 (GRCm39) probably null Het
Tas2r117 T C 6: 132,780,092 (GRCm39) F77L probably benign Het
Tbcd C T 11: 121,492,787 (GRCm39) R875C probably damaging Het
Thumpd2 A G 17: 81,334,230 (GRCm39) S453P probably benign Het
Vars2 G T 17: 35,972,825 (GRCm39) Q13K probably benign Het
Other mutations in Lctl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00944:Lctl APN 9 64,040,411 (GRCm39) nonsense probably null
IGL03066:Lctl APN 9 64,025,017 (GRCm39) start codon destroyed probably null 0.66
IGL03302:Lctl APN 9 64,042,130 (GRCm39) unclassified probably benign
R0077:Lctl UTSW 9 64,029,389 (GRCm39) start codon destroyed probably null 0.64
R0137:Lctl UTSW 9 64,024,980 (GRCm39) utr 5 prime probably benign
R0335:Lctl UTSW 9 64,026,169 (GRCm39) missense probably benign 0.00
R0391:Lctl UTSW 9 64,029,596 (GRCm39) splice site probably benign
R1740:Lctl UTSW 9 64,040,389 (GRCm39) missense probably damaging 1.00
R1866:Lctl UTSW 9 64,039,003 (GRCm39) missense probably damaging 1.00
R2160:Lctl UTSW 9 64,025,049 (GRCm39) missense probably benign 0.02
R2867:Lctl UTSW 9 64,045,150 (GRCm39) missense probably benign 0.23
R2867:Lctl UTSW 9 64,045,150 (GRCm39) missense probably benign 0.23
R3605:Lctl UTSW 9 64,040,475 (GRCm39) missense probably damaging 1.00
R3607:Lctl UTSW 9 64,040,475 (GRCm39) missense probably damaging 1.00
R4585:Lctl UTSW 9 64,038,882 (GRCm39) missense probably damaging 1.00
R4861:Lctl UTSW 9 64,027,045 (GRCm39) missense possibly damaging 0.55
R5249:Lctl UTSW 9 64,045,196 (GRCm39) missense probably benign
R7021:Lctl UTSW 9 64,040,075 (GRCm39) splice site probably null
R7106:Lctl UTSW 9 64,040,119 (GRCm39) missense probably benign 0.22
R7221:Lctl UTSW 9 64,026,217 (GRCm39) nonsense probably null
R7265:Lctl UTSW 9 64,034,203 (GRCm39) missense probably damaging 1.00
R7353:Lctl UTSW 9 64,034,249 (GRCm39) missense probably damaging 1.00
R7501:Lctl UTSW 9 64,038,861 (GRCm39) missense probably benign 0.00
R7615:Lctl UTSW 9 64,029,392 (GRCm39) missense probably damaging 1.00
R7855:Lctl UTSW 9 64,040,498 (GRCm39) missense possibly damaging 0.89
R9077:Lctl UTSW 9 64,039,241 (GRCm39) intron probably benign
R9318:Lctl UTSW 9 64,026,539 (GRCm39) intron probably benign
R9320:Lctl UTSW 9 64,040,455 (GRCm39) missense probably damaging 1.00
R9351:Lctl UTSW 9 64,040,473 (GRCm39) missense possibly damaging 0.94
R9552:Lctl UTSW 9 64,025,049 (GRCm39) missense probably benign 0.02
RF014:Lctl UTSW 9 64,026,212 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTGATAACAGTCCCTCCCC -3'
(R):5'- AGTCAGACTCTAGGCTCTGG -3'

Sequencing Primer
(F):5'- TCAGTGTCAGGCAAGGGTGAC -3'
(R):5'- TGTTAGTCCTCACACCAG -3'
Posted On 2016-03-01