Incidental Mutation 'R0280:R3hdm1'
ID37433
Institutional Source Beutler Lab
Gene Symbol R3hdm1
Ensembl Gene ENSMUSG00000056211
Gene NameR3H domain containing 1
Synonyms
MMRRC Submission 038502-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0280 (G1)
Quality Score209
Status Validated
Chromosome1
Chromosomal Location128103301-128237736 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 128162775 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 74 (S74T)
Ref Sequence ENSEMBL: ENSMUSP00000043103 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036288] [ENSMUST00000187023] [ENSMUST00000187900] [ENSMUST00000188381] [ENSMUST00000189317]
Predicted Effect probably benign
Transcript: ENSMUST00000036288
AA Change: S74T

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000043103
Gene: ENSMUSG00000056211
AA Change: S74T

DomainStartEndE-ValueType
coiled coil region 9 31 N/A INTRINSIC
low complexity region 68 82 N/A INTRINSIC
low complexity region 86 99 N/A INTRINSIC
R3H 151 228 3.18e-22 SMART
Pfam:SUZ 249 302 8.8e-15 PFAM
low complexity region 391 424 N/A INTRINSIC
low complexity region 511 534 N/A INTRINSIC
low complexity region 624 642 N/A INTRINSIC
low complexity region 909 927 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000187023
SMART Domains Protein: ENSMUSP00000139749
Gene: ENSMUSG00000056211

DomainStartEndE-ValueType
R3H 95 172 1.9e-24 SMART
Pfam:SUZ 193 246 2.6e-11 PFAM
low complexity region 335 368 N/A INTRINSIC
low complexity region 455 478 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000187900
AA Change: S74T

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000141142
Gene: ENSMUSG00000056211
AA Change: S74T

DomainStartEndE-ValueType
coiled coil region 9 31 N/A INTRINSIC
low complexity region 68 82 N/A INTRINSIC
low complexity region 86 99 N/A INTRINSIC
R3H 151 228 3.18e-22 SMART
Pfam:SUZ 249 302 2.7e-14 PFAM
low complexity region 391 424 N/A INTRINSIC
low complexity region 511 534 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000188381
SMART Domains Protein: ENSMUSP00000140538
Gene: ENSMUSG00000056211

DomainStartEndE-ValueType
coiled coil region 9 31 N/A INTRINSIC
R3H 107 184 3.18e-22 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000189317
AA Change: S60T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000140175
Gene: ENSMUSG00000056211
AA Change: S60T

DomainStartEndE-ValueType
coiled coil region 9 31 N/A INTRINSIC
low complexity region 72 85 N/A INTRINSIC
R3H 137 214 1.9e-24 SMART
Pfam:SUZ 235 287 2e-11 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191016
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194793
Meta Mutation Damage Score 0.048 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 96.9%
  • 20x: 94.6%
Validation Efficiency 96% (55/57)
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700061G19Rik T A 17: 56,885,169 Y577* probably null Het
Adam18 C T 8: 24,674,054 G38R probably benign Het
Ankrd16 T G 2: 11,781,501 V187G probably damaging Het
AU019823 T C 9: 50,609,379 T123A probably damaging Het
Ccdc110 A T 8: 45,943,450 N793Y probably benign Het
Ccdc170 T C 10: 4,558,663 I629T possibly damaging Het
Clcn6 A G 4: 148,008,715 L836P probably damaging Het
Colgalt2 G T 1: 152,508,561 A551S possibly damaging Het
Crocc T C 4: 141,028,426 E1097G probably damaging Het
Csmd1 A T 8: 16,271,602 V494E probably damaging Het
Drg1 A T 11: 3,256,537 probably null Het
Dscam T C 16: 97,039,006 K134E possibly damaging Het
Dyrk1b T C 7: 28,184,312 Y198H probably damaging Het
Esr1 A G 10: 4,856,951 D289G probably benign Het
Esr1 G T 10: 4,939,289 V396F probably damaging Het
Evi5l T C 8: 4,193,133 V339A probably damaging Het
Fat4 A T 3: 38,890,816 Q1286L probably benign Het
Frem1 T C 4: 82,969,444 H1118R probably damaging Het
Fuk A T 8: 110,894,748 V188D probably damaging Het
Fut9 C T 4: 25,619,852 D321N probably benign Het
Gaa T G 11: 119,284,547 V917G probably damaging Het
Gm973 GCC GC 1: 59,544,680 probably null Het
Kidins220 A G 12: 25,010,141 T767A probably damaging Het
Kif7 A G 7: 79,698,823 S1257P probably benign Het
Ltn1 A G 16: 87,397,838 L1391P probably damaging Het
Mast3 A G 8: 70,783,795 Y681H probably damaging Het
Mast3 A G 8: 70,787,920 V291A possibly damaging Het
Metrn C T 17: 25,795,135 R239H probably benign Het
Mphosph10 C A 7: 64,376,703 K666N possibly damaging Het
Mtbp C T 15: 55,586,461 T433I probably benign Het
Mtmr2 A G 9: 13,799,249 K365E probably damaging Het
Nanog A G 6: 122,713,398 D229G probably damaging Het
Npepps T C 11: 97,241,014 N338S possibly damaging Het
Nphp4 T A 4: 152,551,936 probably benign Het
Olfr1279 T C 2: 111,307,072 F289S possibly damaging Het
Plcl2 A G 17: 50,607,034 E357G probably damaging Het
Polb A T 8: 22,640,392 Y173N probably damaging Het
Raet1d T A 10: 22,370,883 C37S probably damaging Het
Reln G A 5: 22,227,513 probably benign Het
Rps6kc1 T C 1: 190,809,000 S369G probably damaging Het
Sgf29 A G 7: 126,671,571 E108G probably benign Het
Sh3tc1 A G 5: 35,706,017 L942P probably damaging Het
Slc22a27 A T 19: 7,896,822 L188* probably null Het
Slc9a3 T A 13: 74,159,424 I445N probably damaging Het
Sufu A T 19: 46,450,673 probably benign Het
Tomm40 G A 7: 19,713,751 T118I probably damaging Het
Ttc25 A T 11: 100,550,265 K107N probably damaging Het
Ttn C T 2: 76,740,479 R26690H probably damaging Het
Vmn2r16 A G 5: 109,340,139 I293V possibly damaging Het
Vmn2r68 T A 7: 85,233,249 probably benign Het
Vmn2r68 C G 7: 85,233,258 probably null Het
Vsig8 A G 1: 172,561,538 D119G probably benign Het
Other mutations in R3hdm1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00757:R3hdm1 APN 1 128236439 missense probably damaging 1.00
IGL00799:R3hdm1 APN 1 128174963 missense probably damaging 1.00
IGL00835:R3hdm1 APN 1 128235632 splice site probably benign
IGL00885:R3hdm1 APN 1 128236438 missense probably damaging 0.99
IGL00990:R3hdm1 APN 1 128162196 intron probably benign
IGL01137:R3hdm1 APN 1 128181875 missense probably damaging 1.00
IGL01323:R3hdm1 APN 1 128216543 missense probably benign
IGL01461:R3hdm1 APN 1 128178906 missense probably damaging 1.00
IGL01565:R3hdm1 APN 1 128186816 missense probably damaging 1.00
IGL01813:R3hdm1 APN 1 128175233 critical splice donor site probably null
IGL01837:R3hdm1 APN 1 128186760 nonsense probably null
IGL01934:R3hdm1 APN 1 128236535 missense probably benign 0.12
IGL02074:R3hdm1 APN 1 128169038 missense possibly damaging 0.48
IGL02532:R3hdm1 APN 1 128197099 critical splice donor site probably null
IGL02606:R3hdm1 APN 1 128190719 missense probably benign 0.00
IGL02851:R3hdm1 APN 1 128174940 splice site probably benign
driven UTSW 1 128193565 missense probably benign 0.00
R0023:R3hdm1 UTSW 1 128211192 splice site probably benign
R0482:R3hdm1 UTSW 1 128184517 missense probably benign 0.12
R0521:R3hdm1 UTSW 1 128193703 missense probably benign 0.07
R0578:R3hdm1 UTSW 1 128231437 nonsense probably null
R0698:R3hdm1 UTSW 1 128181739 missense probably damaging 1.00
R0701:R3hdm1 UTSW 1 128181739 missense probably damaging 1.00
R0961:R3hdm1 UTSW 1 128193596 missense probably benign 0.13
R1026:R3hdm1 UTSW 1 128197005 missense probably damaging 1.00
R1141:R3hdm1 UTSW 1 128231405 missense probably benign 0.01
R1319:R3hdm1 UTSW 1 128231405 missense probably benign 0.01
R1320:R3hdm1 UTSW 1 128231405 missense probably benign 0.01
R1511:R3hdm1 UTSW 1 128197005 missense probably damaging 1.00
R1705:R3hdm1 UTSW 1 128235084 missense probably damaging 1.00
R1991:R3hdm1 UTSW 1 128169016 missense probably damaging 0.99
R2140:R3hdm1 UTSW 1 128190693 missense probably damaging 0.99
R2437:R3hdm1 UTSW 1 128186836 missense probably damaging 0.98
R2447:R3hdm1 UTSW 1 128186929 intron probably benign
R4564:R3hdm1 UTSW 1 128221659 missense probably benign 0.16
R4640:R3hdm1 UTSW 1 128175238 splice site probably benign
R4649:R3hdm1 UTSW 1 128184444 missense probably damaging 1.00
R4650:R3hdm1 UTSW 1 128184444 missense probably damaging 1.00
R4652:R3hdm1 UTSW 1 128184444 missense probably damaging 1.00
R4653:R3hdm1 UTSW 1 128184444 missense probably damaging 1.00
R4696:R3hdm1 UTSW 1 128236766 utr 3 prime probably benign
R5393:R3hdm1 UTSW 1 128231347 missense probably benign
R5554:R3hdm1 UTSW 1 128236672 missense probably benign 0.27
R5979:R3hdm1 UTSW 1 128211223 missense probably benign 0.04
R6123:R3hdm1 UTSW 1 128169036 missense probably damaging 0.99
R6185:R3hdm1 UTSW 1 128151861 missense possibly damaging 0.93
R6618:R3hdm1 UTSW 1 128193565 missense probably benign 0.00
R6636:R3hdm1 UTSW 1 128162811 frame shift probably null
R6639:R3hdm1 UTSW 1 128162811 frame shift probably null
R6756:R3hdm1 UTSW 1 128162811 frame shift probably null
R7168:R3hdm1 UTSW 1 128216495 missense probably benign 0.05
R7210:R3hdm1 UTSW 1 128211208 missense possibly damaging 0.95
R7367:R3hdm1 UTSW 1 128153392 missense possibly damaging 0.64
X0017:R3hdm1 UTSW 1 128167921 missense possibly damaging 0.92
X0020:R3hdm1 UTSW 1 128169033 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGTTGGAATTATGCCCATTCTTGCT -3'
(R):5'- GTTGGGGTGATTTCCAGAGAATCAACA -3'

Sequencing Primer
(F):5'- GAATTATGCCCATTCTTGCTATTGC -3'
(R):5'- CTCTATTGTAAGCCTCAGAGCAAAG -3'
Posted On2013-05-23