Incidental Mutation 'R4837:Rnf213'
ID 374355
Institutional Source Beutler Lab
Gene Symbol Rnf213
Ensembl Gene ENSMUSG00000070327
Gene Name ring finger protein 213
Synonyms D11Ertd759e
MMRRC Submission 042452-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R4837 (G1)
Quality Score 225
Status Validated
Chromosome 11
Chromosomal Location 119283926-119378244 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to C at 119333589 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glycine to Arginine at position 2934 (G2934R)
Ref Sequence ENSEMBL: ENSMUSP00000091429 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093902] [ENSMUST00000131035]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000093902
AA Change: G2934R

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000091429
Gene: ENSMUSG00000070327
AA Change: G2934R

DomainStartEndE-ValueType
low complexity region 130 146 N/A INTRINSIC
low complexity region 265 279 N/A INTRINSIC
low complexity region 319 335 N/A INTRINSIC
low complexity region 676 688 N/A INTRINSIC
low complexity region 1114 1128 N/A INTRINSIC
low complexity region 1546 1558 N/A INTRINSIC
AAA 2373 2515 2.82e-2 SMART
AAA 2722 2890 3.63e-1 SMART
low complexity region 3449 3459 N/A INTRINSIC
RING 3947 3985 8.69e-5 SMART
Blast:PP2Ac 4544 4722 3e-66 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000131035
AA Change: G2933R

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000115063
Gene: ENSMUSG00000070327
AA Change: G2933R

DomainStartEndE-ValueType
low complexity region 130 146 N/A INTRINSIC
low complexity region 265 279 N/A INTRINSIC
low complexity region 319 335 N/A INTRINSIC
low complexity region 676 688 N/A INTRINSIC
low complexity region 1113 1127 N/A INTRINSIC
low complexity region 1545 1557 N/A INTRINSIC
AAA 2372 2514 2.82e-2 SMART
AAA 2721 2889 3.63e-1 SMART
low complexity region 3448 3458 N/A INTRINSIC
RING 3946 3984 8.69e-5 SMART
Blast:PP2Ac 4542 4720 3e-66 BLAST
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.9%
Validation Efficiency 99% (75/76)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing a C3HC4-type RING finger domain, which is a specialized type of Zn-finger that binds two atoms of zinc and is thought to be involved in mediating protein-protein interactions. The protein also contains an AAA domain, which is associated with ATPase activity. This gene is a susceptibility gene for Moyamoya disease, a vascular disorder of intracranial arteries. This gene is also a translocation partner in anaplastic large cell lymphoma and inflammatory myofibroblastic tumor cases, where a t(2;17)(p23;q25) translocation has been identified with the anaplastic lymphoma kinase (ALK) gene on chromosome 2, and a t(8;17)(q24;q25) translocation has been identified with the MYC gene on chromosome 8. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased body weight and circulating glucose level but normal glucose tolerance, insulin sensitivity, insulin plasma levels and leptin plasma levels. [provided by MGI curators]
Allele List at MGI

All alleles(13) : Targeted, other(2) Gene trapped(11)

Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca14 A T 7: 119,846,203 (GRCm39) H618L probably benign Het
Adgrl3 A G 5: 81,914,081 (GRCm39) T1230A probably benign Het
Ahnak2 A G 12: 112,749,359 (GRCm39) S203P probably benign Het
Allc A G 12: 28,609,308 (GRCm39) V244A probably benign Het
Ap3m1 G A 14: 21,087,225 (GRCm39) P157L probably damaging Het
Arhgef2 T G 3: 88,540,250 (GRCm39) I97S probably damaging Het
Btaf1 C A 19: 36,944,185 (GRCm39) T398K probably benign Het
Cabp1 T C 5: 115,311,212 (GRCm39) M158V probably damaging Het
Ccdc162 G A 10: 41,549,863 (GRCm39) P340L probably benign Het
Ccdc168 G A 1: 44,100,594 (GRCm39) T168I possibly damaging Het
Clip4 A G 17: 72,141,217 (GRCm39) K524E probably damaging Het
Cltc A G 11: 86,586,474 (GRCm39) V189A probably benign Het
Cmc2 A G 8: 117,620,879 (GRCm39) F34S probably damaging Het
Ctcfl G T 2: 172,955,449 (GRCm39) T271N probably benign Het
Cyp4f16 T A 17: 32,761,738 (GRCm39) F124I possibly damaging Het
Ddx41 C A 13: 55,679,461 (GRCm39) R479L possibly damaging Het
Dgcr6 C A 16: 17,884,710 (GRCm39) N87K possibly damaging Het
Dll1 A G 17: 15,589,121 (GRCm39) L518P probably damaging Het
Dnaja4 G T 9: 54,617,928 (GRCm39) M263I probably benign Het
Dusp13b T A 14: 21,793,593 (GRCm39) probably benign Het
Fam185a T A 5: 21,685,375 (GRCm39) I357N probably benign Het
Fam186a T C 15: 99,838,678 (GRCm39) Y2522C unknown Het
Fam222a T A 5: 114,732,458 (GRCm39) C4* probably null Het
Filip1 T C 9: 79,726,741 (GRCm39) D626G probably damaging Het
Ghrhr C T 6: 55,365,172 (GRCm39) R389C probably damaging Het
Gstm3 T A 3: 107,871,531 (GRCm39) T217S probably benign Het
Gucy2g T C 19: 55,214,485 (GRCm39) T548A probably benign Het
Hectd3 T A 4: 116,859,794 (GRCm39) C744S probably null Het
Hnrnpl T C 7: 28,516,762 (GRCm39) S184P probably benign Het
Il3 G A 11: 54,158,083 (GRCm39) probably benign Het
Itga5 C T 15: 103,262,511 (GRCm39) G330S probably damaging Het
Kl A G 5: 150,904,312 (GRCm39) T355A possibly damaging Het
Lipk A C 19: 34,009,720 (GRCm39) S208R probably damaging Het
Mrs2 T A 13: 25,183,040 (GRCm39) probably null Het
Mutyh A G 4: 116,674,887 (GRCm39) E372G probably damaging Het
Myh4 C A 11: 67,149,818 (GRCm39) A1821D probably benign Het
Nfkb2 G T 19: 46,296,006 (GRCm39) E170D probably benign Het
Nlrp12 T C 7: 3,279,693 (GRCm39) E881G probably damaging Het
Nol9 T C 4: 152,136,552 (GRCm39) probably benign Het
Nwd1 A G 8: 73,383,759 (GRCm39) E52G probably damaging Het
Opn4 A G 14: 34,318,261 (GRCm39) V242A probably damaging Het
Or4e1 A T 14: 52,701,103 (GRCm39) M121K probably damaging Het
Or4k44 T A 2: 111,368,319 (GRCm39) H105L probably damaging Het
Or5m13 A G 2: 85,748,748 (GRCm39) T160A probably benign Het
Or6b1 T G 6: 42,814,783 (GRCm39) probably null Het
Or6b2b A G 1: 92,418,697 (GRCm39) V260A probably benign Het
Paxbp1 G A 16: 90,831,866 (GRCm39) Q341* probably null Het
Pcdh7 T C 5: 57,877,753 (GRCm39) V436A possibly damaging Het
Pcdhb18 G A 18: 37,622,867 (GRCm39) V66M probably damaging Het
Pikfyve A G 1: 65,285,749 (GRCm39) E951G possibly damaging Het
Plcg1 A G 2: 160,592,906 (GRCm39) N179S probably benign Het
Prr11 A C 11: 86,989,517 (GRCm39) S285A probably benign Het
Ranbp17 A G 11: 33,278,451 (GRCm39) S139P probably damaging Het
Rasa4 G A 5: 136,120,664 (GRCm39) probably null Het
Rpap1 A G 2: 119,608,732 (GRCm39) V210A probably benign Het
Rpn1 T A 6: 88,067,187 (GRCm39) N182K probably benign Het
Rps24 C T 14: 24,541,855 (GRCm39) T14I possibly damaging Het
Rrp12 C T 19: 41,865,944 (GRCm39) probably null Het
Rttn T A 18: 89,108,539 (GRCm39) probably null Het
Rufy1 A G 11: 50,292,320 (GRCm39) S490P probably damaging Het
Sec62 T A 3: 30,864,018 (GRCm39) M100K unknown Het
Spata16 A G 3: 26,787,081 (GRCm39) H253R possibly damaging Het
Srcap T C 7: 127,158,134 (GRCm39) probably benign Het
Srrm1 A G 4: 135,072,823 (GRCm39) probably benign Het
Tbcd G A 11: 121,473,611 (GRCm39) probably null Het
Tedc2 C A 17: 24,439,567 (GRCm39) A25S probably damaging Het
Tnr A T 1: 159,512,358 (GRCm39) probably benign Het
Tnxb A C 17: 34,936,981 (GRCm39) D3730A probably damaging Het
Tor2a G A 2: 32,650,609 (GRCm39) G201D probably damaging Het
Tpp1 T C 7: 105,395,856 (GRCm39) T558A probably benign Het
Vmn1r211 G T 13: 23,036,296 (GRCm39) Q124K probably benign Het
Wasf3 T C 5: 146,397,788 (GRCm39) V185A probably benign Het
Zbtb12 A G 17: 35,114,985 (GRCm39) T257A probably benign Het
Other mutations in Rnf213
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00336:Rnf213 APN 11 119,340,169 (GRCm39) missense probably benign 0.00
IGL00961:Rnf213 APN 11 119,331,669 (GRCm39) missense possibly damaging 0.55
IGL01324:Rnf213 APN 11 119,338,063 (GRCm39) missense probably damaging 1.00
IGL01351:Rnf213 APN 11 119,373,944 (GRCm39) missense probably benign 0.25
IGL01403:Rnf213 APN 11 119,334,126 (GRCm39) missense probably damaging 1.00
IGL01704:Rnf213 APN 11 119,340,702 (GRCm39) critical splice donor site probably null
IGL01765:Rnf213 APN 11 119,327,178 (GRCm39) missense probably benign 0.00
IGL01803:Rnf213 APN 11 119,332,133 (GRCm39) missense probably damaging 1.00
IGL01804:Rnf213 APN 11 119,333,092 (GRCm39) missense probably damaging 1.00
IGL01900:Rnf213 APN 11 119,333,841 (GRCm39) missense probably benign 0.05
IGL01944:Rnf213 APN 11 119,307,283 (GRCm39) missense probably benign 0.01
IGL01982:Rnf213 APN 11 119,334,094 (GRCm39) missense probably damaging 1.00
IGL02008:Rnf213 APN 11 119,309,135 (GRCm39) splice site probably benign
IGL02084:Rnf213 APN 11 119,336,499 (GRCm39) missense probably benign 0.04
IGL02253:Rnf213 APN 11 119,331,476 (GRCm39) missense probably benign 0.03
IGL02254:Rnf213 APN 11 119,371,733 (GRCm39) missense possibly damaging 0.89
IGL02296:Rnf213 APN 11 119,354,162 (GRCm39) missense probably benign 0.01
IGL02531:Rnf213 APN 11 119,327,628 (GRCm39) missense probably benign
IGL02588:Rnf213 APN 11 119,307,362 (GRCm39) missense probably benign 0.30
IGL02615:Rnf213 APN 11 119,331,615 (GRCm39) missense probably damaging 0.96
IGL02805:Rnf213 APN 11 119,325,892 (GRCm39) missense probably damaging 0.99
IGL02887:Rnf213 APN 11 119,318,336 (GRCm39) missense probably damaging 1.00
IGL03001:Rnf213 APN 11 119,370,767 (GRCm39) missense probably damaging 1.00
IGL03035:Rnf213 APN 11 119,336,452 (GRCm39) splice site probably benign
IGL03057:Rnf213 APN 11 119,331,913 (GRCm39) missense probably damaging 1.00
IGL03148:Rnf213 APN 11 119,355,833 (GRCm39) missense probably damaging 1.00
IGL03308:Rnf213 APN 11 119,364,998 (GRCm39) missense probably benign 0.03
IGL03339:Rnf213 APN 11 119,333,830 (GRCm39) missense probably damaging 1.00
IGL03369:Rnf213 APN 11 119,312,294 (GRCm39) missense probably benign 0.34
attrition UTSW 11 119,321,147 (GRCm39) missense possibly damaging 0.77
defame UTSW 11 119,321,107 (GRCm39) nonsense probably null
Derogate UTSW 11 119,361,036 (GRCm39) missense probably damaging 1.00
dinky UTSW 11 119,307,284 (GRCm39) missense probably damaging 0.99
G1funyon_rnf213_024 UTSW 11 119,325,568 (GRCm39) missense
Impugn UTSW 11 119,327,649 (GRCm39) nonsense probably null
R4332_Rnf213_642 UTSW 11 119,327,502 (GRCm39) missense probably damaging 1.00
B6584:Rnf213 UTSW 11 119,316,895 (GRCm39) missense probably damaging 0.97
G1Funyon:Rnf213 UTSW 11 119,325,568 (GRCm39) missense
PIT4585001:Rnf213 UTSW 11 119,349,218 (GRCm39) missense
R0008:Rnf213 UTSW 11 119,355,878 (GRCm39) missense possibly damaging 0.82
R0015:Rnf213 UTSW 11 119,332,432 (GRCm39) missense possibly damaging 0.95
R0041:Rnf213 UTSW 11 119,293,401 (GRCm39) missense probably benign 0.41
R0114:Rnf213 UTSW 11 119,305,413 (GRCm39) missense probably damaging 1.00
R0131:Rnf213 UTSW 11 119,321,187 (GRCm39) missense probably benign 0.10
R0131:Rnf213 UTSW 11 119,321,187 (GRCm39) missense probably benign 0.10
R0132:Rnf213 UTSW 11 119,321,187 (GRCm39) missense probably benign 0.10
R0138:Rnf213 UTSW 11 119,307,322 (GRCm39) missense probably benign 0.05
R0144:Rnf213 UTSW 11 119,370,426 (GRCm39) nonsense probably null
R0184:Rnf213 UTSW 11 119,305,347 (GRCm39) missense probably damaging 0.99
R0321:Rnf213 UTSW 11 119,328,931 (GRCm39) nonsense probably null
R0365:Rnf213 UTSW 11 119,316,937 (GRCm39) missense possibly damaging 0.74
R0415:Rnf213 UTSW 11 119,305,295 (GRCm39) missense probably damaging 1.00
R0421:Rnf213 UTSW 11 119,338,083 (GRCm39) missense probably damaging 1.00
R0494:Rnf213 UTSW 11 119,316,838 (GRCm39) missense possibly damaging 0.65
R0494:Rnf213 UTSW 11 119,333,946 (GRCm39) missense probably damaging 1.00
R0549:Rnf213 UTSW 11 119,355,908 (GRCm39) missense probably damaging 1.00
R0577:Rnf213 UTSW 11 119,334,106 (GRCm39) missense probably damaging 1.00
R0605:Rnf213 UTSW 11 119,322,543 (GRCm39) missense probably benign 0.03
R0638:Rnf213 UTSW 11 119,361,036 (GRCm39) missense probably damaging 1.00
R0675:Rnf213 UTSW 11 119,332,660 (GRCm39) missense probably benign 0.28
R0715:Rnf213 UTSW 11 119,331,976 (GRCm39) missense probably damaging 0.97
R0732:Rnf213 UTSW 11 119,331,894 (GRCm39) missense probably damaging 0.99
R0748:Rnf213 UTSW 11 119,364,306 (GRCm39) missense probably damaging 1.00
R0765:Rnf213 UTSW 11 119,313,921 (GRCm39) critical splice donor site probably null
R0890:Rnf213 UTSW 11 119,321,312 (GRCm39) missense possibly damaging 0.94
R0927:Rnf213 UTSW 11 119,305,396 (GRCm39) missense probably benign 0.00
R0940:Rnf213 UTSW 11 119,307,389 (GRCm39) missense probably benign 0.10
R0959:Rnf213 UTSW 11 119,343,407 (GRCm39) missense probably damaging 0.99
R1077:Rnf213 UTSW 11 119,376,824 (GRCm39) splice site probably benign
R1104:Rnf213 UTSW 11 119,368,055 (GRCm39) missense probably benign 0.29
R1141:Rnf213 UTSW 11 119,326,809 (GRCm39) missense probably benign 0.02
R1219:Rnf213 UTSW 11 119,327,003 (GRCm39) missense probably damaging 1.00
R1435:Rnf213 UTSW 11 119,326,831 (GRCm39) missense probably damaging 1.00
R1444:Rnf213 UTSW 11 119,333,226 (GRCm39) missense probably damaging 1.00
R1474:Rnf213 UTSW 11 119,328,576 (GRCm39) missense probably damaging 1.00
R1488:Rnf213 UTSW 11 119,371,715 (GRCm39) missense probably benign 0.05
R1523:Rnf213 UTSW 11 119,332,714 (GRCm39) missense probably damaging 1.00
R1548:Rnf213 UTSW 11 119,333,533 (GRCm39) missense probably damaging 1.00
R1554:Rnf213 UTSW 11 119,332,665 (GRCm39) missense probably benign 0.06
R1563:Rnf213 UTSW 11 119,305,352 (GRCm39) missense probably benign 0.13
R1572:Rnf213 UTSW 11 119,327,437 (GRCm39) missense probably damaging 1.00
R1585:Rnf213 UTSW 11 119,354,171 (GRCm39) missense probably damaging 1.00
R1635:Rnf213 UTSW 11 119,333,405 (GRCm39) missense probably damaging 0.97
R1663:Rnf213 UTSW 11 119,328,498 (GRCm39) missense probably benign 0.01
R1789:Rnf213 UTSW 11 119,331,047 (GRCm39) missense probably damaging 0.97
R1844:Rnf213 UTSW 11 119,332,009 (GRCm39) missense probably damaging 1.00
R1871:Rnf213 UTSW 11 119,340,955 (GRCm39) missense probably benign 0.08
R1893:Rnf213 UTSW 11 119,307,274 (GRCm39) missense probably damaging 1.00
R1937:Rnf213 UTSW 11 119,322,511 (GRCm39) missense probably damaging 1.00
R1967:Rnf213 UTSW 11 119,371,721 (GRCm39) missense probably damaging 1.00
R1987:Rnf213 UTSW 11 119,331,933 (GRCm39) missense probably damaging 1.00
R2000:Rnf213 UTSW 11 119,326,848 (GRCm39) missense probably damaging 1.00
R2020:Rnf213 UTSW 11 119,352,744 (GRCm39) missense probably damaging 0.99
R2100:Rnf213 UTSW 11 119,358,128 (GRCm39) nonsense probably null
R2109:Rnf213 UTSW 11 119,333,489 (GRCm39) nonsense probably null
R2115:Rnf213 UTSW 11 119,318,839 (GRCm39) missense probably benign 0.00
R2126:Rnf213 UTSW 11 119,341,027 (GRCm39) missense probably damaging 0.99
R2144:Rnf213 UTSW 11 119,334,516 (GRCm39) missense probably damaging 0.99
R2145:Rnf213 UTSW 11 119,306,019 (GRCm39) missense probably benign 0.03
R2168:Rnf213 UTSW 11 119,305,896 (GRCm39) missense probably damaging 0.97
R2189:Rnf213 UTSW 11 119,321,187 (GRCm39) missense probably benign 0.10
R2199:Rnf213 UTSW 11 119,350,835 (GRCm39) missense probably benign 0.01
R2220:Rnf213 UTSW 11 119,327,254 (GRCm39) missense possibly damaging 0.94
R2336:Rnf213 UTSW 11 119,305,430 (GRCm39) missense probably benign 0.02
R2400:Rnf213 UTSW 11 119,334,021 (GRCm39) missense probably damaging 1.00
R2679:Rnf213 UTSW 11 119,350,764 (GRCm39) splice site probably null
R2698:Rnf213 UTSW 11 119,300,970 (GRCm39) missense probably benign 0.26
R3151:Rnf213 UTSW 11 119,359,718 (GRCm39) missense probably benign 0.03
R3607:Rnf213 UTSW 11 119,332,802 (GRCm39) nonsense probably null
R3808:Rnf213 UTSW 11 119,370,384 (GRCm39) missense probably damaging 1.00
R3854:Rnf213 UTSW 11 119,371,765 (GRCm39) splice site probably benign
R3856:Rnf213 UTSW 11 119,371,765 (GRCm39) splice site probably benign
R3973:Rnf213 UTSW 11 119,359,879 (GRCm39) missense
R4014:Rnf213 UTSW 11 119,336,555 (GRCm39) nonsense probably null
R4049:Rnf213 UTSW 11 119,373,274 (GRCm39) missense possibly damaging 0.67
R4130:Rnf213 UTSW 11 119,373,832 (GRCm39) missense probably damaging 1.00
R4153:Rnf213 UTSW 11 119,300,308 (GRCm39) missense probably benign 0.27
R4167:Rnf213 UTSW 11 119,332,069 (GRCm39) missense probably damaging 0.99
R4224:Rnf213 UTSW 11 119,327,649 (GRCm39) nonsense probably null
R4332:Rnf213 UTSW 11 119,327,502 (GRCm39) missense probably damaging 1.00
R4415:Rnf213 UTSW 11 119,374,790 (GRCm39) missense probably damaging 0.99
R4547:Rnf213 UTSW 11 119,370,496 (GRCm39) critical splice donor site probably null
R4609:Rnf213 UTSW 11 119,328,521 (GRCm39) missense possibly damaging 0.86
R4684:Rnf213 UTSW 11 119,331,951 (GRCm39) missense probably damaging 1.00
R4704:Rnf213 UTSW 11 119,331,175 (GRCm39) missense probably damaging 1.00
R4719:Rnf213 UTSW 11 119,310,893 (GRCm39) missense probably benign 0.38
R4751:Rnf213 UTSW 11 119,336,571 (GRCm39) missense probably benign 0.12
R4828:Rnf213 UTSW 11 119,307,455 (GRCm39) missense possibly damaging 0.61
R4894:Rnf213 UTSW 11 119,372,066 (GRCm39) missense probably damaging 1.00
R4973:Rnf213 UTSW 11 119,318,983 (GRCm39) missense possibly damaging 0.84
R5026:Rnf213 UTSW 11 119,327,590 (GRCm39) missense probably damaging 1.00
R5034:Rnf213 UTSW 11 119,301,633 (GRCm39) missense probably damaging 0.99
R5284:Rnf213 UTSW 11 119,349,692 (GRCm39) missense possibly damaging 0.89
R5295:Rnf213 UTSW 11 119,331,642 (GRCm39) missense probably benign 0.00
R5406:Rnf213 UTSW 11 119,331,634 (GRCm39) missense probably damaging 1.00
R5441:Rnf213 UTSW 11 119,299,846 (GRCm39) missense probably damaging 0.99
R5449:Rnf213 UTSW 11 119,305,902 (GRCm39) missense probably benign 0.44
R5520:Rnf213 UTSW 11 119,324,325 (GRCm39) missense probably damaging 1.00
R5636:Rnf213 UTSW 11 119,327,731 (GRCm39) missense probably damaging 1.00
R5636:Rnf213 UTSW 11 119,327,455 (GRCm39) missense probably benign 0.04
R5669:Rnf213 UTSW 11 119,349,611 (GRCm39) missense possibly damaging 0.92
R5670:Rnf213 UTSW 11 119,325,512 (GRCm39) critical splice acceptor site probably null
R5697:Rnf213 UTSW 11 119,374,720 (GRCm39) missense possibly damaging 0.54
R5726:Rnf213 UTSW 11 119,307,284 (GRCm39) missense probably damaging 0.99
R5808:Rnf213 UTSW 11 119,327,121 (GRCm39) missense probably benign
R5861:Rnf213 UTSW 11 119,364,203 (GRCm39) missense probably damaging 1.00
R5903:Rnf213 UTSW 11 119,312,195 (GRCm39) missense probably damaging 0.98
R5949:Rnf213 UTSW 11 119,333,905 (GRCm39) missense probably damaging 1.00
R6022:Rnf213 UTSW 11 119,376,836 (GRCm39) missense probably benign 0.00
R6043:Rnf213 UTSW 11 119,332,927 (GRCm39) missense probably damaging 0.97
R6089:Rnf213 UTSW 11 119,307,385 (GRCm39) missense probably benign 0.14
R6123:Rnf213 UTSW 11 119,302,339 (GRCm39) missense probably damaging 0.96
R6134:Rnf213 UTSW 11 119,302,296 (GRCm39) missense probably damaging 0.99
R6135:Rnf213 UTSW 11 119,332,854 (GRCm39) missense probably benign 0.02
R6146:Rnf213 UTSW 11 119,326,825 (GRCm39) missense probably benign 0.41
R6163:Rnf213 UTSW 11 119,349,254 (GRCm39) missense possibly damaging 0.86
R6272:Rnf213 UTSW 11 119,305,374 (GRCm39) missense probably damaging 1.00
R6333:Rnf213 UTSW 11 119,354,192 (GRCm39) missense probably damaging 1.00
R6370:Rnf213 UTSW 11 119,367,904 (GRCm39) missense probably damaging 0.99
R6456:Rnf213 UTSW 11 119,350,792 (GRCm39) missense probably benign 0.03
R6468:Rnf213 UTSW 11 119,343,513 (GRCm39) missense possibly damaging 0.94
R6579:Rnf213 UTSW 11 119,327,106 (GRCm39) missense probably damaging 0.96
R6648:Rnf213 UTSW 11 119,370,746 (GRCm39) missense possibly damaging 0.81
R6727:Rnf213 UTSW 11 119,321,147 (GRCm39) missense possibly damaging 0.77
R6739:Rnf213 UTSW 11 119,333,097 (GRCm39) missense probably damaging 1.00
R6768:Rnf213 UTSW 11 119,333,062 (GRCm39) missense probably damaging 0.99
R6817:Rnf213 UTSW 11 119,353,111 (GRCm39) critical splice donor site probably null
R6820:Rnf213 UTSW 11 119,339,664 (GRCm39) missense probably damaging 1.00
R6841:Rnf213 UTSW 11 119,340,692 (GRCm39) missense probably benign 0.26
R6934:Rnf213 UTSW 11 119,310,893 (GRCm39) missense probably benign 0.38
R7026:Rnf213 UTSW 11 119,370,481 (GRCm39) missense possibly damaging 0.58
R7094:Rnf213 UTSW 11 119,328,430 (GRCm39) splice site probably null
R7170:Rnf213 UTSW 11 119,343,401 (GRCm39) missense
R7185:Rnf213 UTSW 11 119,315,024 (GRCm39) missense
R7239:Rnf213 UTSW 11 119,349,614 (GRCm39) missense
R7258:Rnf213 UTSW 11 119,343,401 (GRCm39) missense
R7259:Rnf213 UTSW 11 119,343,401 (GRCm39) missense
R7260:Rnf213 UTSW 11 119,343,401 (GRCm39) missense
R7273:Rnf213 UTSW 11 119,322,582 (GRCm39) splice site probably null
R7282:Rnf213 UTSW 11 119,328,818 (GRCm39) missense
R7311:Rnf213 UTSW 11 119,307,373 (GRCm39) missense
R7352:Rnf213 UTSW 11 119,334,405 (GRCm39) missense
R7369:Rnf213 UTSW 11 119,321,294 (GRCm39) missense
R7410:Rnf213 UTSW 11 119,325,877 (GRCm39) missense
R7448:Rnf213 UTSW 11 119,372,117 (GRCm39) missense
R7561:Rnf213 UTSW 11 119,332,545 (GRCm39) missense
R7573:Rnf213 UTSW 11 119,349,310 (GRCm39) missense
R7615:Rnf213 UTSW 11 119,358,123 (GRCm39) missense
R7680:Rnf213 UTSW 11 119,370,382 (GRCm39) missense
R7739:Rnf213 UTSW 11 119,301,687 (GRCm39) missense
R7789:Rnf213 UTSW 11 119,361,045 (GRCm39) splice site probably null
R7806:Rnf213 UTSW 11 119,302,371 (GRCm39) missense
R8031:Rnf213 UTSW 11 119,321,107 (GRCm39) nonsense probably null
R8042:Rnf213 UTSW 11 119,332,480 (GRCm39) missense
R8053:Rnf213 UTSW 11 119,293,473 (GRCm39) missense
R8284:Rnf213 UTSW 11 119,318,909 (GRCm39) missense
R8301:Rnf213 UTSW 11 119,325,568 (GRCm39) missense
R8325:Rnf213 UTSW 11 119,321,271 (GRCm39) missense
R8332:Rnf213 UTSW 11 119,374,524 (GRCm39) missense
R8443:Rnf213 UTSW 11 119,340,149 (GRCm39) missense
R8518:Rnf213 UTSW 11 119,353,043 (GRCm39) missense
R8531:Rnf213 UTSW 11 119,365,031 (GRCm39) missense probably benign 0.02
R8670:Rnf213 UTSW 11 119,349,563 (GRCm39) missense
R8675:Rnf213 UTSW 11 119,346,984 (GRCm39) missense
R8690:Rnf213 UTSW 11 119,332,038 (GRCm39) missense
R8690:Rnf213 UTSW 11 119,308,955 (GRCm39) missense
R8714:Rnf213 UTSW 11 119,359,720 (GRCm39) missense
R8802:Rnf213 UTSW 11 119,352,928 (GRCm39) missense
R8861:Rnf213 UTSW 11 119,333,062 (GRCm39) missense
R8886:Rnf213 UTSW 11 119,364,264 (GRCm39) missense
R8893:Rnf213 UTSW 11 119,333,868 (GRCm39) missense
R8937:Rnf213 UTSW 11 119,321,100 (GRCm39) missense possibly damaging 0.94
R8941:Rnf213 UTSW 11 119,305,250 (GRCm39) missense probably damaging 1.00
R8973:Rnf213 UTSW 11 119,352,756 (GRCm39) missense
R8983:Rnf213 UTSW 11 119,321,175 (GRCm39) missense
R9043:Rnf213 UTSW 11 119,349,739 (GRCm39) missense
R9081:Rnf213 UTSW 11 119,357,062 (GRCm39) missense
R9132:Rnf213 UTSW 11 119,374,742 (GRCm39) missense
R9135:Rnf213 UTSW 11 119,299,573 (GRCm39) missense
R9146:Rnf213 UTSW 11 119,334,499 (GRCm39) missense
R9156:Rnf213 UTSW 11 119,331,574 (GRCm39) missense
R9183:Rnf213 UTSW 11 119,318,448 (GRCm39) missense
R9234:Rnf213 UTSW 11 119,340,943 (GRCm39) missense
R9275:Rnf213 UTSW 11 119,326,768 (GRCm39) missense
R9278:Rnf213 UTSW 11 119,326,768 (GRCm39) missense
R9296:Rnf213 UTSW 11 119,334,621 (GRCm39) splice site probably benign
R9350:Rnf213 UTSW 11 119,332,975 (GRCm39) missense
R9366:Rnf213 UTSW 11 119,327,057 (GRCm39) missense
R9413:Rnf213 UTSW 11 119,357,059 (GRCm39) missense
R9444:Rnf213 UTSW 11 119,325,623 (GRCm39) missense
R9464:Rnf213 UTSW 11 119,354,406 (GRCm39) missense
R9605:Rnf213 UTSW 11 119,359,879 (GRCm39) missense
R9649:Rnf213 UTSW 11 119,370,457 (GRCm39) missense
R9651:Rnf213 UTSW 11 119,331,238 (GRCm39) missense
R9664:Rnf213 UTSW 11 119,332,794 (GRCm39) missense
R9696:Rnf213 UTSW 11 119,359,806 (GRCm39) missense
R9710:Rnf213 UTSW 11 119,331,831 (GRCm39) missense
R9797:Rnf213 UTSW 11 119,333,365 (GRCm39) missense
S24628:Rnf213 UTSW 11 119,305,295 (GRCm39) missense probably damaging 1.00
X0021:Rnf213 UTSW 11 119,332,650 (GRCm39) missense probably benign 0.14
X0062:Rnf213 UTSW 11 119,364,339 (GRCm39) missense probably benign 0.05
X0064:Rnf213 UTSW 11 119,331,289 (GRCm39) missense probably damaging 1.00
Z1088:Rnf213 UTSW 11 119,368,080 (GRCm39) missense possibly damaging 0.69
Z1176:Rnf213 UTSW 11 119,373,824 (GRCm39) missense
Z1176:Rnf213 UTSW 11 119,332,236 (GRCm39) missense
Predicted Primers PCR Primer
(F):5'- TCTGCTCTTCAGACAGGCTG -3'
(R):5'- GCCACATAGTTCCTGGTCAG -3'

Sequencing Primer
(F):5'- TCTTCAGACAGGCTGGTGCAG -3'
(R):5'- ACATAGTTCCTGGTCAGCACGAG -3'
Posted On 2016-03-01