Incidental Mutation 'R4837:Fam186a'
ID374365
Institutional Source Beutler Lab
Gene Symbol Fam186a
Ensembl Gene ENSMUSG00000045350
Gene Namefamily with sequence similarity 186, member A
SynonymsLOC380973, 1700030F18Rik
MMRRC Submission 042452-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.110) question?
Stock #R4837 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location99918348-99967061 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 99940797 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 2522 (Y2522C)
Ref Sequence ENSEMBL: ENSMUSP00000097783 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000100209]
Predicted Effect unknown
Transcript: ENSMUST00000100209
AA Change: Y2522C
SMART Domains Protein: ENSMUSP00000097783
Gene: ENSMUSG00000045350
AA Change: Y2522C

DomainStartEndE-ValueType
low complexity region 10 21 N/A INTRINSIC
Blast:FBG 44 222 4e-48 BLAST
coiled coil region 292 340 N/A INTRINSIC
low complexity region 423 443 N/A INTRINSIC
low complexity region 446 458 N/A INTRINSIC
low complexity region 632 644 N/A INTRINSIC
low complexity region 702 713 N/A INTRINSIC
internal_repeat_2 743 1156 1.05e-58 PROSPERO
internal_repeat_1 833 1270 7.71e-59 PROSPERO
low complexity region 1271 1285 N/A INTRINSIC
low complexity region 1289 1300 N/A INTRINSIC
low complexity region 1309 1323 N/A INTRINSIC
low complexity region 1327 1338 N/A INTRINSIC
low complexity region 1347 1361 N/A INTRINSIC
low complexity region 1365 1376 N/A INTRINSIC
low complexity region 1384 1395 N/A INTRINSIC
low complexity region 1403 1414 N/A INTRINSIC
low complexity region 1423 1437 N/A INTRINSIC
low complexity region 1441 1452 N/A INTRINSIC
low complexity region 1460 1471 N/A INTRINSIC
low complexity region 1479 1490 N/A INTRINSIC
low complexity region 1498 1509 N/A INTRINSIC
low complexity region 1518 1532 N/A INTRINSIC
low complexity region 1536 1547 N/A INTRINSIC
low complexity region 1555 1566 N/A INTRINSIC
low complexity region 1574 1585 N/A INTRINSIC
internal_repeat_1 1586 1981 7.71e-59 PROSPERO
internal_repeat_2 1737 2197 1.05e-58 PROSPERO
low complexity region 2367 2378 N/A INTRINSIC
low complexity region 2549 2564 N/A INTRINSIC
low complexity region 2644 2655 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000104255
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177831
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180309
Meta Mutation Damage Score 0.0412 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.9%
Validation Efficiency 99% (75/76)
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca14 A T 7: 120,246,980 H618L probably benign Het
Adgrl3 A G 5: 81,766,234 T1230A probably benign Het
Ahnak2 A G 12: 112,785,739 S203P probably benign Het
Allc A G 12: 28,559,309 V244A probably benign Het
Ap3m1 G A 14: 21,037,157 P157L probably damaging Het
Arhgef2 T G 3: 88,632,943 I97S probably damaging Het
Btaf1 C A 19: 36,966,785 T398K probably benign Het
Cabp1 T C 5: 115,173,153 M158V probably damaging Het
Ccdc162 G A 10: 41,673,867 P340L probably benign Het
Clip4 A G 17: 71,834,222 K524E probably damaging Het
Cltc A G 11: 86,695,648 V189A probably benign Het
Cmc2 A G 8: 116,894,140 F34S probably damaging Het
Ctcfl G T 2: 173,113,656 T271N probably benign Het
Cyp4f16 T A 17: 32,542,764 F124I possibly damaging Het
Ddx41 C A 13: 55,531,648 R479L possibly damaging Het
Dgcr6 C A 16: 18,066,846 N87K possibly damaging Het
Dll1 A G 17: 15,368,859 L518P probably damaging Het
Dnaja4 G T 9: 54,710,644 M263I probably benign Het
Dusp13 T A 14: 21,743,525 probably benign Het
Fam185a T A 5: 21,480,377 I357N probably benign Het
Fam222a T A 5: 114,594,397 C4* probably null Het
Filip1 T C 9: 79,819,459 D626G probably damaging Het
Ghrhr C T 6: 55,388,187 R389C probably damaging Het
Gm8251 G A 1: 44,061,434 T168I possibly damaging Het
Gstm3 T A 3: 107,964,215 T217S probably benign Het
Gucy2g T C 19: 55,226,053 T548A probably benign Het
Hectd3 T A 4: 117,002,597 C744S probably null Het
Hnrnpl T C 7: 28,817,337 S184P probably benign Het
Il3 G A 11: 54,267,257 probably benign Het
Itga5 C T 15: 103,354,084 G330S probably damaging Het
Kl A G 5: 150,980,847 T355A possibly damaging Het
Lipk A C 19: 34,032,320 S208R probably damaging Het
Mrs2 T A 13: 24,999,057 probably null Het
Mutyh A G 4: 116,817,690 E372G probably damaging Het
Myh4 C A 11: 67,258,992 A1821D probably benign Het
Nfkb2 G T 19: 46,307,567 E170D probably benign Het
Nlrp12 T C 7: 3,231,061 E881G probably damaging Het
Nol9 T C 4: 152,052,095 probably benign Het
Nwd1 A G 8: 72,657,131 E52G probably damaging Het
Olfr1025-ps1 A G 2: 85,918,404 T160A probably benign Het
Olfr1294 T A 2: 111,537,974 H105L probably damaging Het
Olfr1415 A G 1: 92,490,975 V260A probably benign Het
Olfr1508 A T 14: 52,463,646 M121K probably damaging Het
Olfr449 T G 6: 42,837,849 probably null Het
Opn4 A G 14: 34,596,304 V242A probably damaging Het
Paxbp1 G A 16: 91,034,978 Q341* probably null Het
Pcdh7 T C 5: 57,720,411 V436A possibly damaging Het
Pcdhb18 G A 18: 37,489,814 V66M probably damaging Het
Pikfyve A G 1: 65,246,590 E951G possibly damaging Het
Plcg1 A G 2: 160,750,986 N179S probably benign Het
Prr11 A C 11: 87,098,691 S285A probably benign Het
Ranbp17 A G 11: 33,328,451 S139P probably damaging Het
Rasa4 G A 5: 136,091,810 probably null Het
Rnf213 G C 11: 119,442,763 G2934R probably benign Het
Rpap1 A G 2: 119,778,251 V210A probably benign Het
Rpn1 T A 6: 88,090,205 N182K probably benign Het
Rps24 C T 14: 24,491,787 T14I possibly damaging Het
Rrp12 C T 19: 41,877,505 probably null Het
Rttn T A 18: 89,090,415 probably null Het
Rufy1 A G 11: 50,401,493 S490P probably damaging Het
Sec62 T A 3: 30,809,869 M100K unknown Het
Spata16 A G 3: 26,732,932 H253R possibly damaging Het
Srcap T C 7: 127,558,962 probably benign Het
Srrm1 A G 4: 135,345,512 probably benign Het
Tbcd G A 11: 121,582,785 probably null Het
Tedc2 C A 17: 24,220,593 A25S probably damaging Het
Tnr A T 1: 159,684,788 probably benign Het
Tnxb A C 17: 34,718,007 D3730A probably damaging Het
Tor2a G A 2: 32,760,597 G201D probably damaging Het
Tpp1 T C 7: 105,746,649 T558A probably benign Het
Vmn1r211 G T 13: 22,852,126 Q124K probably benign Het
Wasf3 T C 5: 146,460,978 V185A probably benign Het
Zbtb12 A G 17: 34,896,009 T257A probably benign Het
Other mutations in Fam186a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00588:Fam186a APN 15 99927691 splice site probably benign
IGL03047:Fam186a UTSW 15 99945708 missense unknown
R0172:Fam186a UTSW 15 99954887 missense unknown
R0194:Fam186a UTSW 15 99941763 missense possibly damaging 0.92
R0381:Fam186a UTSW 15 99942174 missense probably damaging 0.97
R0799:Fam186a UTSW 15 99942012 missense probably damaging 1.00
R1295:Fam186a UTSW 15 99939789 splice site probably benign
R1366:Fam186a UTSW 15 99943389 missense possibly damaging 0.89
R1519:Fam186a UTSW 15 99947655 missense unknown
R1592:Fam186a UTSW 15 99940318 missense probably benign 0.01
R1636:Fam186a UTSW 15 99941658 missense unknown
R1719:Fam186a UTSW 15 99942346 missense possibly damaging 0.54
R1759:Fam186a UTSW 15 99966881 nonsense probably null
R1856:Fam186a UTSW 15 99940302 missense possibly damaging 0.82
R2131:Fam186a UTSW 15 99933676 unclassified probably benign
R2192:Fam186a UTSW 15 99940311 missense possibly damaging 0.90
R2239:Fam186a UTSW 15 99954864 missense unknown
R2251:Fam186a UTSW 15 99945097 missense probably benign 0.02
R2902:Fam186a UTSW 15 99945168 missense possibly damaging 0.73
R3037:Fam186a UTSW 15 99943794 missense probably damaging 0.99
R3744:Fam186a UTSW 15 99947535 missense unknown
R4021:Fam186a UTSW 15 99941799 missense possibly damaging 0.66
R4183:Fam186a UTSW 15 99933685 unclassified probably benign
R4238:Fam186a UTSW 15 99943642 missense probably benign 0.05
R4667:Fam186a UTSW 15 99944532 missense possibly damaging 0.92
R4817:Fam186a UTSW 15 99933538 unclassified probably benign
R4835:Fam186a UTSW 15 99945808 missense unknown
R4897:Fam186a UTSW 15 99945277 missense possibly damaging 0.66
R4902:Fam186a UTSW 15 99946842 missense unknown
R4950:Fam186a UTSW 15 99941653 missense unknown
R4995:Fam186a UTSW 15 99945099 missense probably benign 0.27
R5062:Fam186a UTSW 15 99944646 missense possibly damaging 0.66
R5124:Fam186a UTSW 15 99943096 missense possibly damaging 0.90
R5133:Fam186a UTSW 15 99955493 missense unknown
R5424:Fam186a UTSW 15 99945763 missense unknown
R5624:Fam186a UTSW 15 99941747 missense possibly damaging 0.90
R5628:Fam186a UTSW 15 99941747 missense possibly damaging 0.90
R5637:Fam186a UTSW 15 99941747 missense possibly damaging 0.90
R5639:Fam186a UTSW 15 99947050 missense unknown
R5652:Fam186a UTSW 15 99945372 missense possibly damaging 0.79
R5673:Fam186a UTSW 15 99941747 missense possibly damaging 0.90
R5799:Fam186a UTSW 15 99966824 nonsense probably null
R5965:Fam186a UTSW 15 99945097 missense probably benign 0.37
R6044:Fam186a UTSW 15 99941997 missense probably damaging 0.97
R6077:Fam186a UTSW 15 99942703 missense possibly damaging 0.46
R6120:Fam186a UTSW 15 99940363 missense probably benign 0.00
R6185:Fam186a UTSW 15 99947649 missense unknown
R6186:Fam186a UTSW 15 99947325 missense unknown
R6242:Fam186a UTSW 15 99939907 missense unknown
R6351:Fam186a UTSW 15 99941742 missense probably damaging 0.97
R6368:Fam186a UTSW 15 99943317 missense possibly damaging 0.66
R6369:Fam186a UTSW 15 99947331 missense unknown
R6559:Fam186a UTSW 15 99944475 missense possibly damaging 0.46
R6855:Fam186a UTSW 15 99954875 missense unknown
R6867:Fam186a UTSW 15 99945850 missense unknown
R6957:Fam186a UTSW 15 99946476 missense unknown
R6961:Fam186a UTSW 15 99940201 missense probably benign 0.16
R6994:Fam186a UTSW 15 99942466 missense probably benign 0.35
R6996:Fam186a UTSW 15 99955493 missense unknown
R7062:Fam186a UTSW 15 99933640 unclassified probably benign
R7064:Fam186a UTSW 15 99941676 missense unknown
X0021:Fam186a UTSW 15 99945435 missense probably benign 0.00
Z1088:Fam186a UTSW 15 99945994 missense unknown
Predicted Primers PCR Primer
(F):5'- ACATTGGGAGCTCCTCATGG -3'
(R):5'- TTACCTTGGAGAAGCCTGCC -3'

Sequencing Primer
(F):5'- GAGCCTCCAGAAACAAGTCCTGG -3'
(R):5'- AGAAGCCTGCCACGTTG -3'
Posted On2016-03-01