Incidental Mutation 'R4247:Gnal'
ID374388
Institutional Source Beutler Lab
Gene Symbol Gnal
Ensembl Gene ENSMUSG00000024524
Gene Nameguanine nucleotide binding protein, alpha stimulating, olfactory type
SynonymsGna10, 9630020G10Rik, Galphaolf, 2610011C15Rik, Golf, G alpha 10
MMRRC Submission 041063-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.689) question?
Stock #R4247 (G1)
Quality Score51
Status Validated
Chromosome18
Chromosomal Location67088336-67226792 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to G at 67088583 bp
ZygosityHeterozygous
Amino Acid Change Proline to Arginine at position 19 (P19R)
Ref Sequence ENSEMBL: ENSMUSP00000025402 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025402]
Predicted Effect unknown
Transcript: ENSMUST00000025402
AA Change: P19R
SMART Domains Protein: ENSMUSP00000025402
Gene: ENSMUSG00000024524
AA Change: P19R

DomainStartEndE-ValueType
low complexity region 32 46 N/A INTRINSIC
G_alpha 89 447 1.18e-172 SMART
Meta Mutation Damage Score 0.114 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 98% (41/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a stimulatory G protein alpha subunit which mediates odorant signaling in the olfactory epithelium. This protein couples dopamine type 1 receptors and adenosine A2A receptors and is widely expressed in the central nervous system. Mutations in this gene have been associated with dystonia 25 and this gene is located in a susceptibility region for bipolar disorder and schizophrenia. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2013]
PHENOTYPE: Homozygous for a targeted mutation fail to feed, and ~75% die within 2 days after birth. Rare survivors reach sexual maturity and mate but are hyperactive and anosmic, exhibitng severely reduced odor-evoked electrophysical responses and significantly perturbed maternal behaviors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810474O19Rik T A 6: 149,325,543 M29K possibly damaging Het
AA792892 A G 5: 94,383,587 D110G possibly damaging Het
Adam22 T C 5: 8,145,626 I305V probably benign Het
Aga T A 8: 53,511,830 L9Q possibly damaging Het
Akna C T 4: 63,395,172 G238D probably benign Het
Arhgap23 G A 11: 97,463,699 E813K probably damaging Het
Atp13a2 T C 4: 140,992,228 probably null Het
Atp8a1 C T 5: 67,667,574 G820S probably damaging Het
Ccdc97 T G 7: 25,716,034 H68P possibly damaging Het
Dclre1b A C 3: 103,804,084 probably null Het
Erap1 T C 13: 74,675,295 I816T probably damaging Het
Fubp1 G A 3: 152,231,936 A103T possibly damaging Het
Grasp G T 15: 101,224,537 R79L possibly damaging Het
Gtf3c5 T C 2: 28,571,184 D306G probably damaging Het
Hecw2 C T 1: 53,832,645 V1381M probably damaging Het
Hsdl2 A T 4: 59,594,417 N16I probably damaging Het
Kif14 G T 1: 136,473,388 M492I possibly damaging Het
Kif27 A G 13: 58,287,917 V1354A probably damaging Het
Kif9 G T 9: 110,495,959 probably null Het
Lmtk3 G A 7: 45,794,062 C723Y possibly damaging Het
Lrrc24 A G 15: 76,717,976 I193T possibly damaging Het
Olfr1344 A G 7: 6,438,902 probably benign Het
Olfr690 T C 7: 105,330,148 I15V probably benign Het
Pkd1l1 C T 11: 8,865,543 R1456K possibly damaging Het
Ranbp2 A G 10: 58,478,864 D1802G possibly damaging Het
Satl1 A G X: 112,406,336 S141P probably benign Het
Scn11a C T 9: 119,807,886 V250M probably damaging Het
Slitrk1 A G 14: 108,912,562 V239A possibly damaging Het
Slitrk6 T A 14: 110,750,739 D512V probably damaging Het
Snx8 A G 5: 140,356,045 L121P probably damaging Het
Sumf1 A C 6: 108,155,013 V156G probably damaging Het
Trp73 A G 4: 154,064,632 probably null Het
Tsen2 A G 6: 115,547,824 probably benign Het
Upp1 T C 11: 9,134,815 I178T probably benign Het
Vmn2r73 A T 7: 85,872,675 L152Q probably damaging Het
Vmn2r97 T C 17: 18,947,280 S599P possibly damaging Het
Wrnip1 T C 13: 32,806,883 L375P probably damaging Het
Zfp945 C T 17: 22,850,609 G793D probably damaging Het
Zfyve9 C A 4: 108,719,192 A231S probably benign Het
Other mutations in Gnal
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00790:Gnal APN 18 67134289 splice site probably null
IGL01290:Gnal APN 18 67211098 missense probably damaging 1.00
IGL02097:Gnal APN 18 67217208 splice site probably benign
IGL02519:Gnal APN 18 67088765 missense unknown
IGL02691:Gnal APN 18 67222675 missense probably damaging 1.00
R0455:Gnal UTSW 18 67135649 splice site probably benign
R0506:Gnal UTSW 18 67088673 missense unknown
R2107:Gnal UTSW 18 67213578 missense probably damaging 1.00
R3937:Gnal UTSW 18 67135370 splice site probably null
R4246:Gnal UTSW 18 67088583 missense unknown
R4299:Gnal UTSW 18 67088583 missense unknown
R4343:Gnal UTSW 18 67135588 missense probably benign 0.29
R5309:Gnal UTSW 18 67213107 missense possibly damaging 0.49
R5579:Gnal UTSW 18 67088771 missense unknown
R5939:Gnal UTSW 18 67191385 missense probably damaging 0.98
R6277:Gnal UTSW 18 67213072 missense probably damaging 1.00
R7031:Gnal UTSW 18 67222588 missense probably damaging 0.99
R7142:Gnal UTSW 18 67218528 missense probably damaging 1.00
R7343:Gnal UTSW 18 67135525 missense probably benign 0.03
R7366:Gnal UTSW 18 67211071 missense possibly damaging 0.58
Z1088:Gnal UTSW 18 67191403 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGATGCACAATGGCCCTTC -3'
(R):5'- ACATTCTCCAAGGCAGGGTC -3'

Sequencing Primer
(F):5'- CCTTCGGGGCAGTGAGG -3'
(R):5'- GTGCAGACCTACCCAGCAG -3'
Posted On2016-03-04