Incidental Mutation 'R0280:Olfr1279'
ID37439
Institutional Source Beutler Lab
Gene Symbol Olfr1279
Ensembl Gene ENSMUSG00000109813
Gene Nameolfactory receptor 1279
SynonymsMOR245-12, GA_x6K02T2Q125-72357646-72358581
MMRRC Submission 038502-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.203) question?
Stock #R0280 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location111300635-111309043 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 111307072 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 289 (F289S)
Ref Sequence ENSEMBL: ENSMUSP00000149972 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062407] [ENSMUST00000090329] [ENSMUST00000213823] [ENSMUST00000216697]
Predicted Effect
SMART Domains Protein: ENSMUSP00000052153
Gene: ENSMUSG00000108931
AA Change: F289S

DomainStartEndE-ValueType
Pfam:7tm_4 31 305 7.2e-45 PFAM
Pfam:7TM_GPCR_Srsx 34 302 2.4e-5 PFAM
Pfam:7tm_1 41 287 2e-18 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000090329
AA Change: F291S

PolyPhen 2 Score 0.478 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000087801
Gene: ENSMUSG00000109813
AA Change: F291S

DomainStartEndE-ValueType
Pfam:7tm_4 33 306 1.7e-44 PFAM
Pfam:7TM_GPCR_Srsx 36 300 3.2e-5 PFAM
Pfam:7tm_1 43 289 7.4e-18 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000213823
AA Change: F289S

PolyPhen 2 Score 0.478 (Sensitivity: 0.89; Specificity: 0.90)
Predicted Effect possibly damaging
Transcript: ENSMUST00000216697
AA Change: F289S

PolyPhen 2 Score 0.478 (Sensitivity: 0.89; Specificity: 0.90)
Meta Mutation Damage Score 0.0496 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 96.9%
  • 20x: 94.6%
Validation Efficiency 96% (55/57)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700061G19Rik T A 17: 56,885,169 Y577* probably null Het
Adam18 C T 8: 24,674,054 G38R probably benign Het
Ankrd16 T G 2: 11,781,501 V187G probably damaging Het
AU019823 T C 9: 50,609,379 T123A probably damaging Het
Ccdc110 A T 8: 45,943,450 N793Y probably benign Het
Ccdc170 T C 10: 4,558,663 I629T possibly damaging Het
Clcn6 A G 4: 148,008,715 L836P probably damaging Het
Colgalt2 G T 1: 152,508,561 A551S possibly damaging Het
Crocc T C 4: 141,028,426 E1097G probably damaging Het
Csmd1 A T 8: 16,271,602 V494E probably damaging Het
Drg1 A T 11: 3,256,537 probably null Het
Dscam T C 16: 97,039,006 K134E possibly damaging Het
Dyrk1b T C 7: 28,184,312 Y198H probably damaging Het
Esr1 A G 10: 4,856,951 D289G probably benign Het
Esr1 G T 10: 4,939,289 V396F probably damaging Het
Evi5l T C 8: 4,193,133 V339A probably damaging Het
Fat4 A T 3: 38,890,816 Q1286L probably benign Het
Frem1 T C 4: 82,969,444 H1118R probably damaging Het
Fuk A T 8: 110,894,748 V188D probably damaging Het
Fut9 C T 4: 25,619,852 D321N probably benign Het
Gaa T G 11: 119,284,547 V917G probably damaging Het
Gm973 GCC GC 1: 59,544,680 probably null Het
Kidins220 A G 12: 25,010,141 T767A probably damaging Het
Kif7 A G 7: 79,698,823 S1257P probably benign Het
Ltn1 A G 16: 87,397,838 L1391P probably damaging Het
Mast3 A G 8: 70,783,795 Y681H probably damaging Het
Mast3 A G 8: 70,787,920 V291A possibly damaging Het
Metrn C T 17: 25,795,135 R239H probably benign Het
Mphosph10 C A 7: 64,376,703 K666N possibly damaging Het
Mtbp C T 15: 55,586,461 T433I probably benign Het
Mtmr2 A G 9: 13,799,249 K365E probably damaging Het
Nanog A G 6: 122,713,398 D229G probably damaging Het
Npepps T C 11: 97,241,014 N338S possibly damaging Het
Nphp4 T A 4: 152,551,936 probably benign Het
Plcl2 A G 17: 50,607,034 E357G probably damaging Het
Polb A T 8: 22,640,392 Y173N probably damaging Het
R3hdm1 T A 1: 128,162,775 S74T probably benign Het
Raet1d T A 10: 22,370,883 C37S probably damaging Het
Reln G A 5: 22,227,513 probably benign Het
Rps6kc1 T C 1: 190,809,000 S369G probably damaging Het
Sgf29 A G 7: 126,671,571 E108G probably benign Het
Sh3tc1 A G 5: 35,706,017 L942P probably damaging Het
Slc22a27 A T 19: 7,896,822 L188* probably null Het
Slc9a3 T A 13: 74,159,424 I445N probably damaging Het
Sufu A T 19: 46,450,673 probably benign Het
Tomm40 G A 7: 19,713,751 T118I probably damaging Het
Ttc25 A T 11: 100,550,265 K107N probably damaging Het
Ttn C T 2: 76,740,479 R26690H probably damaging Het
Vmn2r16 A G 5: 109,340,139 I293V possibly damaging Het
Vmn2r68 T A 7: 85,233,249 probably benign Het
Vmn2r68 C G 7: 85,233,258 probably null Het
Vsig8 A G 1: 172,561,538 D119G probably benign Het
Other mutations in Olfr1279
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01095:Olfr1279 APN 2 111306621 missense probably benign 0.19
IGL01355:Olfr1279 APN 2 111307093 missense probably benign 0.00
IGL01864:Olfr1279 APN 2 111307055 missense probably damaging 1.00
IGL02160:Olfr1279 APN 2 111306798 missense probably benign 0.02
IGL02183:Olfr1279 APN 2 111306418 missense probably damaging 0.98
PIT4377001:Olfr1279 UTSW 2 111306880 missense probably damaging 1.00
R0636:Olfr1279 UTSW 2 111306412 missense probably benign 0.06
R0732:Olfr1279 UTSW 2 111306980 nonsense probably null
R1661:Olfr1279 UTSW 2 111306771 missense probably damaging 1.00
R1665:Olfr1279 UTSW 2 111306771 missense probably damaging 1.00
R2251:Olfr1279 UTSW 2 111306310 missense probably damaging 1.00
R2252:Olfr1279 UTSW 2 111306310 missense probably damaging 1.00
R2253:Olfr1279 UTSW 2 111306310 missense probably damaging 1.00
R2473:Olfr1279 UTSW 2 111306891 missense probably damaging 1.00
R3408:Olfr1279 UTSW 2 111306505 missense probably damaging 1.00
R5020:Olfr1279 UTSW 2 111306292 missense probably benign 0.01
R5634:Olfr1279 UTSW 2 111307092 missense probably benign
R5647:Olfr1279 UTSW 2 111307047 missense possibly damaging 0.67
R6782:Olfr1279 UTSW 2 111306745 missense probably damaging 1.00
R6911:Olfr1279 UTSW 2 111306273 missense probably benign 0.00
R7135:Olfr1279 UTSW 2 111307020 missense probably benign 0.05
R7167:Olfr1279 UTSW 2 111306448 missense probably benign 0.10
X0021:Olfr1279 UTSW 2 111306588 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCGACTTCCCTCGGATCATACAAC -3'
(R):5'- ACTAGGTTTTGTCACCTGCTGCTG -3'

Sequencing Primer
(F):5'- TCGGATCATACAACTGGCGTG -3'
(R):5'- TCTGCTACAAACAGCCCTTT -3'
Posted On2013-05-23