Incidental Mutation 'R4496:Ikzf5'
ID374402
Institutional Source Beutler Lab
Gene Symbol Ikzf5
Ensembl Gene ENSMUSG00000040167
Gene NameIKAROS family zinc finger 5
SynonymsZfpn1a5, 2610034F18Rik
MMRRC Submission 041749-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.291) question?
Stock #R4496 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location131388652-131410521 bp(-) (GRCm38)
Type of Mutationunclassified (77 bp from exon)
DNA Base Change (assembly) T to C at 131396664 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000117823 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046306] [ENSMUST00000121033] [ENSMUST00000124096] [ENSMUST00000128432] [ENSMUST00000142349] [ENSMUST00000154602] [ENSMUST00000207243]
Predicted Effect probably benign
Transcript: ENSMUST00000046306
SMART Domains Protein: ENSMUSP00000035583
Gene: ENSMUSG00000040167

DomainStartEndE-ValueType
ZnF_C2H2 82 104 3.58e-2 SMART
ZnF_C2H2 110 132 1.53e-1 SMART
ZnF_C2H2 138 161 1.79e-2 SMART
low complexity region 289 320 N/A INTRINSIC
ZnF_C2H2 364 386 8.09e0 SMART
ZnF_C2H2 392 416 9.22e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000121033
SMART Domains Protein: ENSMUSP00000113714
Gene: ENSMUSG00000040167

DomainStartEndE-ValueType
ZnF_C2H2 82 104 3.58e-2 SMART
low complexity region 136 167 N/A INTRINSIC
ZnF_C2H2 211 233 8.09e0 SMART
ZnF_C2H2 239 263 9.22e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000124096
SMART Domains Protein: ENSMUSP00000130971
Gene: ENSMUSG00000030849

DomainStartEndE-ValueType
Pfam:Pkinase 1 118 4.8e-19 PFAM
Pfam:Pkinase_Tyr 1 118 1.7e-50 PFAM
low complexity region 146 160 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000128432
SMART Domains Protein: ENSMUSP00000139528
Gene: ENSMUSG00000040167

DomainStartEndE-ValueType
ZnF_C2H2 82 104 1.5e-4 SMART
Predicted Effect probably null
Transcript: ENSMUST00000142349
Predicted Effect probably benign
Transcript: ENSMUST00000154602
SMART Domains Protein: ENSMUSP00000123530
Gene: ENSMUSG00000040167

DomainStartEndE-ValueType
ZnF_C2H2 82 104 3.58e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000207243
Predicted Effect probably benign
Transcript: ENSMUST00000207489
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207838
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208084
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208700
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208966
Meta Mutation Damage Score 0.6292 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 100% (50/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Members of the Ikaros (ZNFN1A1; MIM 603023) family of transcription factors, which includes Pegasus, are expressed in lymphocytes and are implicated in the control of lymphoid development.[supplied by OMIM, Jul 2002]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca3 T A 17: 24,383,973 L514H possibly damaging Het
Abca7 T C 10: 80,002,934 F647S probably damaging Het
Ahi1 A G 10: 20,965,545 K244E probably benign Het
Ankhd1 G A 18: 36,560,786 D17N probably damaging Het
Arvcf G T 16: 18,405,182 K890N probably damaging Het
Atp11c T C X: 60,280,744 D478G probably damaging Het
Clasrp C A 7: 19,585,240 probably benign Het
Clca2 C T 3: 145,092,165 D180N possibly damaging Het
Comt T C 16: 18,411,687 probably null Het
Cylc2 C G 4: 51,229,651 T331R unknown Het
Cyp2d11 C T 15: 82,391,948 probably benign Het
D10Jhu81e T C 10: 78,163,543 I145V probably damaging Het
Elmsan1 C T 12: 84,156,471 G886S probably benign Het
Fam169b G T 7: 68,358,206 C289F possibly damaging Het
Fam214a T A 9: 75,031,531 S1038T probably damaging Het
Fastkd5 T C 2: 130,616,581 T30A probably benign Het
Fchsd2 A C 7: 101,282,495 T753P probably benign Het
Glis3 G A 19: 28,666,127 S5L possibly damaging Het
Gpr158 T A 2: 21,826,999 M970K probably damaging Het
Gpt A T 15: 76,698,463 Q276L probably damaging Het
Gtf3c3 G T 1: 54,424,132 S302R probably benign Het
Hnrnpc A G 14: 52,075,431 S229P probably benign Het
Mal2 T C 15: 54,598,439 V110A probably damaging Het
Myo3b A G 2: 70,254,404 D702G probably benign Het
Myo9b G A 8: 71,334,337 R721Q probably benign Het
Nat10 T A 2: 103,757,739 I14F probably damaging Het
Nat14 C T 7: 4,923,919 T30M probably damaging Het
Ndst4 C A 3: 125,683,273 A49D probably damaging Het
Nnt A T 13: 119,381,765 M292K probably damaging Het
Obox7 C T 7: 14,665,374 T175I probably benign Het
Olfr1395 T A 11: 49,148,387 N43K possibly damaging Het
Olfr787 T G 10: 129,463,561 V295G possibly damaging Het
Plekhm3 T C 1: 64,861,236 E634G probably damaging Het
Plxdc2 T A 2: 16,512,229 I107K probably damaging Het
Psmb10 T A 8: 105,936,028 R226S probably damaging Het
Ptprr T A 10: 116,229,502 V160E possibly damaging Het
Sema5a T A 15: 32,640,987 L649H probably damaging Het
Sephs1 T A 2: 4,906,683 I356K probably benign Het
Serpinb3d C T 1: 107,079,292 V229M probably damaging Het
Slc7a4 T C 16: 17,575,812 D41G probably damaging Het
Sort1 T C 3: 108,310,145 V121A probably benign Het
Tcf20 C A 15: 82,854,984 Q755H probably damaging Het
Tmem181a T A 17: 6,295,786 L185H probably damaging Het
Ttll13 A T 7: 80,256,919 Y445F probably benign Het
Usp40 T C 1: 87,995,737 I271V possibly damaging Het
Vmn1r72 A G 7: 11,669,864 I219T probably damaging Het
Other mutations in Ikzf5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03149:Ikzf5 APN 7 131396765 missense probably damaging 1.00
R0545:Ikzf5 UTSW 7 131392500 missense possibly damaging 0.87
R0583:Ikzf5 UTSW 7 131391785 unclassified probably null
R1471:Ikzf5 UTSW 7 131391767 missense probably damaging 1.00
R2680:Ikzf5 UTSW 7 131396761 missense probably damaging 1.00
R4625:Ikzf5 UTSW 7 131393753 critical splice donor site probably null
R6307:Ikzf5 UTSW 7 131391648 missense probably damaging 1.00
R6828:Ikzf5 UTSW 7 131391672 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AACCTTTCAAGAAGACTGTAACAAT -3'
(R):5'- TGTTCCCTAGATATAACAGACTTTCAA -3'

Sequencing Primer
(F):5'- TGGTGGCTCACAAACATCTG -3'
(R):5'- AACCAGAGCCTTTGGACT -3'
Posted On2016-03-07