Incidental Mutation 'R4427:Ccdc88b'
ID374417
Institutional Source Beutler Lab
Gene Symbol Ccdc88b
Ensembl Gene ENSMUSG00000047810
Gene Namecoiled-coil domain containing 88B
Synonyms
MMRRC Submission 041145-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.199) question?
Stock #R4427 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location6844623-6858211 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 6850572 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Lysine at position 878 (E878K)
Ref Sequence ENSEMBL: ENSMUSP00000109067 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000113440]
Predicted Effect probably damaging
Transcript: ENSMUST00000113440
AA Change: E878K

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000109067
Gene: ENSMUSG00000047810
AA Change: E878K

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
low complexity region 29 50 N/A INTRINSIC
Pfam:HOOK 91 503 1.2e-16 PFAM
coiled coil region 731 1308 N/A INTRINSIC
low complexity region 1420 1429 N/A INTRINSIC
Meta Mutation Damage Score 0.426 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.0%
Validation Efficiency 96% (48/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the hook-related protein family. Members of this family are characterized by an N-terminal potential microtubule binding domain, a central coiled-coiled and a C-terminal Hook-related domain. The encoded protein may be involved in linking organelles to microtubules. [provided by RefSeq, Oct 2009]
PHENOTYPE: Mice homozygous for a null ENU-induced allele exhibit decreased susceptibility to P. berghei infection with reduced T cell proliferation, decreased cytokine secretion and increased myeloid cell number. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930432E11Rik A T 7: 29,579,253 noncoding transcript Het
A2ml1 T C 6: 128,545,046 E1271G probably benign Het
BC053393 T A 11: 46,584,420 F147L probably benign Het
BC055324 A G 1: 163,954,284 V858A probably benign Het
Ccdc189 A G 7: 127,588,116 probably benign Het
Crybg3 T C 16: 59,543,199 K2441E probably damaging Het
Cryga A T 1: 65,100,616 I121N probably damaging Het
Dst A T 1: 34,181,460 Q2115L probably benign Het
Evi2 T A 11: 79,516,356 Q131L possibly damaging Het
Exoc1 A G 5: 76,563,263 I61V probably benign Het
Frem2 A G 3: 53,539,162 probably null Het
Gas2l1 A G 11: 5,063,908 V184A probably benign Het
Gsto2 T C 19: 47,871,773 S2P possibly damaging Het
Herc1 T C 9: 66,496,005 L4402P probably damaging Het
Kcnd2 T A 6: 21,216,897 I200N probably damaging Het
Klhl30 A G 1: 91,353,704 D9G probably damaging Het
Ltf C A 9: 111,023,604 T178K probably damaging Het
Memo1 T A 17: 74,202,307 Y239F probably benign Het
Ogdh C T 11: 6,355,421 T972I probably benign Het
Phactr4 T C 4: 132,387,041 D24G possibly damaging Het
Pi4ka C T 16: 17,281,044 R1992H probably damaging Het
Poc1b T C 10: 99,155,139 probably null Het
Ppp1r9b A T 11: 95,001,324 R188S possibly damaging Het
Pwwp2a T C 11: 43,682,517 V142A possibly damaging Het
Rab36 G A 10: 75,044,496 V63I probably damaging Het
Rap1gap2 C A 11: 74,407,322 A491S possibly damaging Het
Rcsd1 C A 1: 165,655,895 V206L probably damaging Het
Rps6ka2 T A 17: 7,299,405 D687E possibly damaging Het
Sgce G A 6: 4,691,459 A295V probably damaging Het
Siglec15 T G 18: 78,043,621 E341A possibly damaging Het
Tcaim T C 9: 122,814,496 F87S probably benign Het
Thbs2 C A 17: 14,680,335 V537L probably benign Het
Tmx3 T A 18: 90,523,601 V158D probably damaging Het
Tpm1 A G 9: 67,032,565 probably benign Het
Trmt2a A G 16: 18,249,229 probably benign Het
Ugcg T A 4: 59,219,555 F297L probably benign Het
Utp18 T C 11: 93,866,438 N467D probably damaging Het
Vmn2r73 A G 7: 85,857,773 F777S probably damaging Het
Vwc2 A G 11: 11,154,235 T256A probably damaging Het
Zfp300 C T X: 21,083,166 V120I possibly damaging Het
Zfp982 A T 4: 147,512,623 R146* probably null Het
Other mutations in Ccdc88b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01347:Ccdc88b APN 19 6845086 missense probably damaging 1.00
IGL01637:Ccdc88b APN 19 6846710 missense probably benign 0.13
IGL02201:Ccdc88b APN 19 6846631 missense probably damaging 1.00
IGL02260:Ccdc88b APN 19 6855349 splice site probably benign
IGL02276:Ccdc88b APN 19 6856107 critical splice donor site probably null
IGL02412:Ccdc88b APN 19 6846644 missense probably damaging 1.00
IGL02420:Ccdc88b APN 19 6856949 missense probably damaging 1.00
IGL02990:Ccdc88b APN 19 6847409 missense probably damaging 1.00
R0031:Ccdc88b UTSW 19 6853783 missense possibly damaging 0.93
R0544:Ccdc88b UTSW 19 6857266 missense probably damaging 1.00
R0727:Ccdc88b UTSW 19 6854214 missense probably benign
R0920:Ccdc88b UTSW 19 6846649 missense probably benign
R0975:Ccdc88b UTSW 19 6846625 missense probably damaging 1.00
R1170:Ccdc88b UTSW 19 6853213 missense probably damaging 1.00
R1363:Ccdc88b UTSW 19 6850371 missense possibly damaging 0.55
R1471:Ccdc88b UTSW 19 6854023 missense probably benign
R1605:Ccdc88b UTSW 19 6850469 missense probably benign 0.06
R1752:Ccdc88b UTSW 19 6853322 missense probably benign 0.02
R1832:Ccdc88b UTSW 19 6853532 nonsense probably null
R1839:Ccdc88b UTSW 19 6854109 splice site probably benign
R1917:Ccdc88b UTSW 19 6849226 missense probably damaging 1.00
R2167:Ccdc88b UTSW 19 6854084 missense possibly damaging 0.52
R4012:Ccdc88b UTSW 19 6848991 missense probably damaging 0.98
R4350:Ccdc88b UTSW 19 6850272 missense probably damaging 0.97
R4676:Ccdc88b UTSW 19 6853000 missense probably benign 0.00
R4677:Ccdc88b UTSW 19 6848268 missense probably damaging 0.98
R4720:Ccdc88b UTSW 19 6857715 missense probably damaging 1.00
R4725:Ccdc88b UTSW 19 6857113 missense probably damaging 1.00
R4747:Ccdc88b UTSW 19 6856141 missense probably damaging 1.00
R5092:Ccdc88b UTSW 19 6848232 missense probably damaging 0.99
R5403:Ccdc88b UTSW 19 6857740 missense unknown
R5448:Ccdc88b UTSW 19 6854580 missense probably damaging 1.00
R5771:Ccdc88b UTSW 19 6853835 missense probably benign
R5783:Ccdc88b UTSW 19 6853916 missense probably benign 0.19
R5988:Ccdc88b UTSW 19 6855980 missense probably damaging 1.00
R6328:Ccdc88b UTSW 19 6849038 missense probably damaging 1.00
R6459:Ccdc88b UTSW 19 6854878 missense possibly damaging 0.92
R6773:Ccdc88b UTSW 19 6849041 missense possibly damaging 0.71
X0021:Ccdc88b UTSW 19 6853831 missense probably benign
Predicted Primers PCR Primer
(F):5'- CGGTACCTACCAGGAGAAAC -3'
(R):5'- ATCCTACAAAGCTGCTGGCAC -3'

Sequencing Primer
(F):5'- GAGAAACCTTAACACCCAGTCCTTC -3'
(R):5'- CAAGGCCTCATATTGAGCTTAGGC -3'
Posted On2016-03-11