Incidental Mutation 'R4551:Zfp180'
ID374420
Institutional Source Beutler Lab
Gene Symbol Zfp180
Ensembl Gene ENSMUSG00000057101
Gene Namezinc finger protein 180
SynonymsHHZ168, 2310040I01Rik, D130011P11
MMRRC Submission 041782-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.228) question?
Stock #R4551 (G1)
Quality Score30
Status Validated
Chromosome7
Chromosomal Location24081924-24107713 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 24104573 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Threonine at position 139 (K139T)
Ref Sequence ENSEMBL: ENSMUSP00000064611 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068975] [ENSMUST00000203854] [ENSMUST00000206184] [ENSMUST00000207002]
Predicted Effect possibly damaging
Transcript: ENSMUST00000068975
AA Change: K139T

PolyPhen 2 Score 0.871 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000064611
Gene: ENSMUSG00000057101
AA Change: K139T

DomainStartEndE-ValueType
Blast:KRAB 46 103 7e-14 BLAST
ZnF_C2H2 318 340 3.21e-4 SMART
ZnF_C2H2 346 368 3.39e-3 SMART
ZnF_C2H2 374 396 1.72e-4 SMART
ZnF_C2H2 402 424 4.87e-4 SMART
ZnF_C2H2 430 452 1.58e-3 SMART
ZnF_C2H2 458 480 5.99e-4 SMART
ZnF_C2H2 486 508 2.12e-4 SMART
ZnF_C2H2 514 536 1.6e-4 SMART
ZnF_C2H2 542 564 3.95e-4 SMART
ZnF_C2H2 570 592 5.9e-3 SMART
ZnF_C2H2 598 620 1.12e-3 SMART
ZnF_C2H2 626 648 4.11e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000203854
SMART Domains Protein: ENSMUSP00000145165
Gene: ENSMUSG00000057101

DomainStartEndE-ValueType
Blast:KRAB 12 69 4e-14 BLAST
ZnF_C2H2 284 306 3.21e-4 SMART
ZnF_C2H2 312 334 3.39e-3 SMART
ZnF_C2H2 340 362 1.72e-4 SMART
ZnF_C2H2 368 390 4.87e-4 SMART
ZnF_C2H2 396 418 1.58e-3 SMART
ZnF_C2H2 424 446 5.99e-4 SMART
ZnF_C2H2 452 474 2.12e-4 SMART
ZnF_C2H2 480 502 1.6e-4 SMART
ZnF_C2H2 508 530 3.95e-4 SMART
ZnF_C2H2 536 558 5.9e-3 SMART
ZnF_C2H2 564 586 1.12e-3 SMART
ZnF_C2H2 592 614 4.11e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000206184
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206482
Predicted Effect probably benign
Transcript: ENSMUST00000207002
Meta Mutation Damage Score 0.168 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.5%
Validation Efficiency 100% (71/71)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Zinc finger proteins have been shown to interact with nucleic acids and to have diverse functions. The zinc finger domain is a conserved amino acid sequence motif containing 2 specifically positioned cysteines and 2 histidines that are involved in coordinating zinc. Kruppel-related proteins form 1 family of zinc finger proteins. See MIM 604749 for additional information on zinc finger proteins.[supplied by OMIM, Jul 2002]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aatk T G 11: 120,011,569 E610A probably benign Het
Abhd17b T C 19: 21,680,926 S176P possibly damaging Het
Adgrg7 A G 16: 56,748,012 Y427H probably damaging Het
Alox15 T A 11: 70,344,596 I647L probably benign Het
Ankhd1 C A 18: 36,655,507 probably null Het
Arid1a A C 4: 133,695,699 probably benign Het
Armcx5 T A X: 135,746,507 V444D probably damaging Het
C4bp A G 1: 130,636,727 Y407H possibly damaging Het
Cog6 T A 3: 52,998,320 E96V probably damaging Het
Cox20 A C 1: 178,322,549 N96T probably benign Het
Cpa3 T C 3: 20,219,770 I351V probably benign Het
Cpd C T 11: 76,811,886 G552D probably damaging Het
Cyld A G 8: 88,707,134 K184E possibly damaging Het
Dab2 G A 15: 6,435,294 G324D probably damaging Het
Depdc1a T A 3: 159,522,584 D324E probably damaging Het
Dnah9 T C 11: 65,841,366 E4238G probably damaging Het
Dync1i1 T A 6: 5,923,206 D275E probably benign Het
Epgn A T 5: 91,027,562 K14* probably null Het
Farp2 T A 1: 93,618,592 L868Q possibly damaging Het
Gpr45 A G 1: 43,032,790 T198A probably benign Het
Grk2 C T 19: 4,286,056 V402M possibly damaging Het
Gsap A T 5: 21,290,571 D79V probably damaging Het
Gtf2h3 A G 5: 124,590,419 probably benign Het
Hus1b C A 13: 30,947,076 S200I probably damaging Het
Hypk A G 2: 121,453,480 probably null Het
Ikbke T C 1: 131,258,033 probably benign Het
Kat6b A G 14: 21,661,448 E670G probably damaging Het
Kif26b T A 1: 178,884,035 I740N probably damaging Het
Lhx3 G A 2: 26,201,190 P369L probably damaging Het
Man2c1 T C 9: 57,131,161 L35P probably damaging Het
Micalcl T A 7: 112,381,916 S366T possibly damaging Het
Mroh9 A T 1: 163,044,093 I607N probably damaging Het
Mybphl T C 3: 108,374,163 I65T possibly damaging Het
Myo1g A G 11: 6,517,874 I187T probably damaging Het
Myo7b T C 18: 31,985,108 S822G probably benign Het
Nkx2-4 C A 2: 147,084,922 A142S probably benign Het
Obscn T C 11: 59,131,646 R758G possibly damaging Het
Odf4 C T 11: 68,922,040 S264N probably benign Het
Olfr360 G T 2: 37,068,343 V13L probably benign Het
Olfr45 A T 7: 140,691,742 Y279F probably damaging Het
Olfr657 A T 7: 104,636,424 H250L probably damaging Het
Papolb T C 5: 142,529,178 I237V probably benign Het
Parpbp T A 10: 88,093,702 Q428L possibly damaging Het
Pcdhb16 T C 18: 37,479,834 F616L probably damaging Het
Pdk3 A T X: 93,782,240 M253K probably damaging Het
Pgap2 C A 7: 102,226,467 probably benign Het
Pkhd1l1 C A 15: 44,550,885 N2849K probably damaging Het
Pprc1 A G 19: 46,067,225 probably benign Het
Psma2 A G 13: 14,616,845 Y25C possibly damaging Het
Ptgir A G 7: 16,906,869 M29V possibly damaging Het
Ptpn5 C A 7: 47,090,852 probably benign Het
Pxn G T 5: 115,552,720 probably benign Het
Scd3 C A 19: 44,215,439 A22E probably benign Het
Sdr42e1 T C 8: 117,663,608 E98G probably benign Het
Slc14a2 A C 18: 78,195,853 S184A probably benign Het
Tmem236 A T 2: 14,219,153 Q251L probably benign Het
Trappc8 T C 18: 20,874,672 T129A probably benign Het
Vmn1r90 A C 7: 14,561,969 M68R possibly damaging Het
Vmn2r105 A G 17: 20,226,351 V462A probably benign Het
Vmn2r7 T C 3: 64,690,689 T816A possibly damaging Het
Vmn2r81 T A 10: 79,268,407 I288K possibly damaging Het
Zfp932 T C 5: 110,009,639 V401A probably benign Het
Other mutations in Zfp180
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00337:Zfp180 APN 7 24085469 missense probably damaging 0.98
IGL00990:Zfp180 APN 7 24104830 missense probably benign 0.42
IGL00990:Zfp180 APN 7 24104995 missense possibly damaging 0.60
IGL00990:Zfp180 APN 7 24104416 missense possibly damaging 0.83
IGL01061:Zfp180 APN 7 24104745 missense possibly damaging 0.50
IGL01328:Zfp180 APN 7 24101479 missense probably benign 0.01
IGL03134:Zfp180 UTSW 7 24104745 missense possibly damaging 0.50
R0137:Zfp180 UTSW 7 24105733 missense possibly damaging 0.93
R0390:Zfp180 UTSW 7 24104707 missense possibly damaging 0.95
R1451:Zfp180 UTSW 7 24105218 missense probably benign 0.00
R1534:Zfp180 UTSW 7 24101523 missense probably benign 0.31
R1555:Zfp180 UTSW 7 24101574 intron probably benign
R1577:Zfp180 UTSW 7 24105908 missense probably damaging 1.00
R1605:Zfp180 UTSW 7 24104624 missense probably benign 0.00
R1633:Zfp180 UTSW 7 24104801 missense probably benign 0.07
R1817:Zfp180 UTSW 7 24105227 missense probably damaging 1.00
R2012:Zfp180 UTSW 7 24104518 missense probably benign 0.01
R2076:Zfp180 UTSW 7 24105103 missense probably damaging 1.00
R2151:Zfp180 UTSW 7 24105260 missense probably damaging 1.00
R2262:Zfp180 UTSW 7 24104624 missense probably benign 0.32
R3081:Zfp180 UTSW 7 24105503 missense probably damaging 1.00
R3402:Zfp180 UTSW 7 24105745 missense probably benign 0.30
R4747:Zfp180 UTSW 7 24105821 missense probably damaging 1.00
R4983:Zfp180 UTSW 7 24106078 missense probably damaging 0.98
R5610:Zfp180 UTSW 7 24104890 missense probably benign 0.00
R5764:Zfp180 UTSW 7 24101484 missense possibly damaging 0.71
R5987:Zfp180 UTSW 7 24105434 missense probably damaging 1.00
R6207:Zfp180 UTSW 7 24105085 nonsense probably null
R6247:Zfp180 UTSW 7 24105105 missense probably damaging 1.00
R6328:Zfp180 UTSW 7 24105556 missense probably damaging 1.00
R6708:Zfp180 UTSW 7 24106096 missense probably damaging 0.98
R6814:Zfp180 UTSW 7 24105881 missense probably damaging 1.00
R6872:Zfp180 UTSW 7 24105881 missense probably damaging 1.00
R7006:Zfp180 UTSW 7 24105112 nonsense probably null
R7084:Zfp180 UTSW 7 24105261 missense probably damaging 1.00
R7101:Zfp180 UTSW 7 24104533 missense probably benign 0.00
R7213:Zfp180 UTSW 7 24104513 missense possibly damaging 0.87
R7263:Zfp180 UTSW 7 24105700 nonsense probably null
R7360:Zfp180 UTSW 7 24105490 missense probably damaging 1.00
R7487:Zfp180 UTSW 7 24106100 missense probably damaging 1.00
V5622:Zfp180 UTSW 7 24082031 start gained probably benign
X0067:Zfp180 UTSW 7 24105472 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGACTAATACGGGTGCCTTG -3'
(R):5'- TTTTGGTGACTGCTTGCAAC -3'

Sequencing Primer
(F):5'- ACTAATACGGGTGCCTTGCTGTAC -3'
(R):5'- GTGACTGCTTGCAACGACATC -3'
Posted On2016-03-11