Incidental Mutation 'R0280:Nanog'
ID37449
Institutional Source Beutler Lab
Gene Symbol Nanog
Ensembl Gene ENSMUSG00000012396
Gene NameNanog homeobox
Synonyms2410002E02Rik, ecat4, ENK
MMRRC Submission 038502-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0280 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location122707489-122714633 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 122713398 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 229 (D229G)
Ref Sequence ENSEMBL: ENSMUSP00000108200 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000012540] [ENSMUST00000112580] [ENSMUST00000112581]
Predicted Effect probably damaging
Transcript: ENSMUST00000012540
AA Change: D254G

PolyPhen 2 Score 0.958 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000012540
Gene: ENSMUSG00000012396
AA Change: D254G

DomainStartEndE-ValueType
low complexity region 13 25 N/A INTRINSIC
HOX 96 158 5.33e-22 SMART
low complexity region 206 230 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000112580
AA Change: D229G

PolyPhen 2 Score 0.958 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000108199
Gene: ENSMUSG00000012396
AA Change: D229G

DomainStartEndE-ValueType
HOX 71 133 5.33e-22 SMART
low complexity region 181 205 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000112581
AA Change: D229G

PolyPhen 2 Score 0.958 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000108200
Gene: ENSMUSG00000012396
AA Change: D229G

DomainStartEndE-ValueType
HOX 71 133 5.33e-22 SMART
low complexity region 181 205 N/A INTRINSIC
Meta Mutation Damage Score 0.026 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 96.9%
  • 20x: 94.6%
Validation Efficiency 96% (55/57)
MGI Phenotype FUNCTION: The protein encoded by this gene is a DNA binding homeobox transcription factor involved in embryonic stem (ES) cell proliferation, renewal, and pluripotency. The encoded protein can block ES cell differentiation and can also autorepress its own expression in differentiating cells. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2015]
PHENOTYPE: Mice homozygous for a disruption in this gene die between E3.5 and E5.5 with abnormal embryonic and extraembryonic tissue development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700061G19Rik T A 17: 56,885,169 Y577* probably null Het
Adam18 C T 8: 24,674,054 G38R probably benign Het
Ankrd16 T G 2: 11,781,501 V187G probably damaging Het
AU019823 T C 9: 50,609,379 T123A probably damaging Het
Ccdc110 A T 8: 45,943,450 N793Y probably benign Het
Ccdc170 T C 10: 4,558,663 I629T possibly damaging Het
Clcn6 A G 4: 148,008,715 L836P probably damaging Het
Colgalt2 G T 1: 152,508,561 A551S possibly damaging Het
Crocc T C 4: 141,028,426 E1097G probably damaging Het
Csmd1 A T 8: 16,271,602 V494E probably damaging Het
Drg1 A T 11: 3,256,537 probably null Het
Dscam T C 16: 97,039,006 K134E possibly damaging Het
Dyrk1b T C 7: 28,184,312 Y198H probably damaging Het
Esr1 A G 10: 4,856,951 D289G probably benign Het
Esr1 G T 10: 4,939,289 V396F probably damaging Het
Evi5l T C 8: 4,193,133 V339A probably damaging Het
Fat4 A T 3: 38,890,816 Q1286L probably benign Het
Frem1 T C 4: 82,969,444 H1118R probably damaging Het
Fuk A T 8: 110,894,748 V188D probably damaging Het
Fut9 C T 4: 25,619,852 D321N probably benign Het
Gaa T G 11: 119,284,547 V917G probably damaging Het
Gm973 GCC GC 1: 59,544,680 probably null Het
Kidins220 A G 12: 25,010,141 T767A probably damaging Het
Kif7 A G 7: 79,698,823 S1257P probably benign Het
Ltn1 A G 16: 87,397,838 L1391P probably damaging Het
Mast3 A G 8: 70,783,795 Y681H probably damaging Het
Mast3 A G 8: 70,787,920 V291A possibly damaging Het
Metrn C T 17: 25,795,135 R239H probably benign Het
Mphosph10 C A 7: 64,376,703 K666N possibly damaging Het
Mtbp C T 15: 55,586,461 T433I probably benign Het
Mtmr2 A G 9: 13,799,249 K365E probably damaging Het
Npepps T C 11: 97,241,014 N338S possibly damaging Het
Nphp4 T A 4: 152,551,936 probably benign Het
Olfr1279 T C 2: 111,307,072 F289S possibly damaging Het
Plcl2 A G 17: 50,607,034 E357G probably damaging Het
Polb A T 8: 22,640,392 Y173N probably damaging Het
R3hdm1 T A 1: 128,162,775 S74T probably benign Het
Raet1d T A 10: 22,370,883 C37S probably damaging Het
Reln G A 5: 22,227,513 probably benign Het
Rps6kc1 T C 1: 190,809,000 S369G probably damaging Het
Sgf29 A G 7: 126,671,571 E108G probably benign Het
Sh3tc1 A G 5: 35,706,017 L942P probably damaging Het
Slc22a27 A T 19: 7,896,822 L188* probably null Het
Slc9a3 T A 13: 74,159,424 I445N probably damaging Het
Sufu A T 19: 46,450,673 probably benign Het
Tomm40 G A 7: 19,713,751 T118I probably damaging Het
Ttc25 A T 11: 100,550,265 K107N probably damaging Het
Ttn C T 2: 76,740,479 R26690H probably damaging Het
Vmn2r16 A G 5: 109,340,139 I293V possibly damaging Het
Vmn2r68 T A 7: 85,233,249 probably benign Het
Vmn2r68 C G 7: 85,233,258 probably null Het
Vsig8 A G 1: 172,561,538 D119G probably benign Het
Other mutations in Nanog
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00475:Nanog APN 6 122711536 critical splice acceptor site probably null
IGL03278:Nanog APN 6 122711745 missense probably damaging 1.00
IGL03387:Nanog APN 6 122711772 missense probably damaging 1.00
R1443:Nanog UTSW 6 122711775 missense probably damaging 1.00
R2520:Nanog UTSW 6 122713459 missense probably benign 0.08
R3037:Nanog UTSW 6 122713268 missense possibly damaging 0.81
R4486:Nanog UTSW 6 122712717 critical splice donor site probably null
R4770:Nanog UTSW 6 122711591 missense possibly damaging 0.63
R4790:Nanog UTSW 6 122707915 missense probably benign 0.00
R4825:Nanog UTSW 6 122713340 missense probably benign 0.09
R4931:Nanog UTSW 6 122707906 missense possibly damaging 0.95
R6010:Nanog UTSW 6 122713296 missense probably benign 0.16
R6025:Nanog UTSW 6 122713391 missense possibly damaging 0.94
X0065:Nanog UTSW 6 122707793 missense probably benign
Predicted Primers PCR Primer
(F):5'- ACCTCTTTCAGAAGGGCTCAGCAC -3'
(R):5'- TCACCTGGTGGAGTCACAGAGTAG -3'

Sequencing Primer
(F):5'- GGAGTATCCCAGCATCCATTG -3'
(R):5'- GTTCAGGAATAATTCCAAGGCTTGTG -3'
Posted On2013-05-23