Incidental Mutation 'R4862:2210010C04Rik'
ID374589
Institutional Source Beutler Lab
Gene Symbol 2210010C04Rik
Ensembl Gene ENSMUSG00000029882
Gene NameRIKEN cDNA 2210010C04 gene
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.090) question?
Stock #R4862 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location41030268-41035509 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 41032411 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Alanine at position 163 (D163A)
Ref Sequence ENSEMBL: ENSMUSP00000031931 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031931]
Predicted Effect possibly damaging
Transcript: ENSMUST00000031931
AA Change: D163A

PolyPhen 2 Score 0.736 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000031931
Gene: ENSMUSG00000029882
AA Change: D163A

DomainStartEndE-ValueType
Tryp_SPc 24 240 3.52e-102 SMART
Meta Mutation Damage Score 0.0644 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency 95% (40/42)
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5330417C22Rik A G 3: 108,467,833 S573P probably benign Het
Acox3 A G 5: 35,589,739 T167A probably benign Het
Aox1 T G 1: 58,095,157 D1096E probably damaging Het
Arid4a A T 12: 71,075,947 D1034V probably damaging Het
Chaf1b T A 16: 93,887,134 L91Q probably damaging Het
Copb2 G T 9: 98,581,267 D512Y probably damaging Het
Daam1 A G 12: 71,942,207 E127G unknown Het
Dhx16 A G 17: 35,883,262 I422V probably benign Het
Dnah6 C T 6: 73,121,788 V2043I probably damaging Het
Dnase1l1 C T X: 74,277,038 probably null Het
Dync2h1 A G 9: 7,147,717 V971A probably benign Het
Elmo1 A G 13: 20,449,512 H448R probably benign Het
Fndc1 A T 17: 7,769,735 V1165D unknown Het
Gm8251 G A 1: 44,058,018 P1307S possibly damaging Het
Hapln1 G A 13: 89,601,452 G39S possibly damaging Het
Igkv6-13 C A 6: 70,457,781 V27L probably benign Het
Krt28 A T 11: 99,365,110 I441N possibly damaging Het
Lgr5 A T 10: 115,462,764 D286E probably damaging Het
Mapkap1 A G 2: 34,623,430 Y448C probably damaging Het
Olfr1094 T A 2: 86,829,532 V260E probably damaging Het
Olfr453 T C 6: 42,744,555 Y173H possibly damaging Het
Ppt1 A C 4: 122,844,449 N89T probably damaging Het
Ptgs1 G T 2: 36,237,255 R51L probably damaging Het
Slc47a2 A G 11: 61,313,694 F277S possibly damaging Het
Smcr8 A G 11: 60,778,071 E15G probably benign Het
Tbce A G 13: 13,998,419 S476P possibly damaging Het
Tmem131l A T 3: 83,898,210 probably benign Het
Unc5c T C 3: 141,789,773 Y468H probably damaging Het
Ush1c A T 7: 46,229,240 L117H probably damaging Het
Wdfy4 A G 14: 33,100,903 probably null Het
Zfa-ps G T 10: 52,543,096 noncoding transcript Het
Zfat C A 15: 68,180,110 A605S probably benign Het
Zfp853 T A 5: 143,289,661 Q68L unknown Het
Zfyve16 G A 13: 92,508,256 T1146I probably damaging Het
Other mutations in 2210010C04Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01120:2210010C04Rik APN 6 41031673 missense probably damaging 1.00
IGL01625:2210010C04Rik APN 6 41032948 missense probably benign 0.01
IGL02159:2210010C04Rik APN 6 41032957 missense probably benign 0.34
IGL03161:2210010C04Rik APN 6 41034306 missense probably damaging 0.96
R0419:2210010C04Rik UTSW 6 41034347 missense probably benign 0.05
R1715:2210010C04Rik UTSW 6 41032936 splice site probably null
R2057:2210010C04Rik UTSW 6 41032381 missense probably benign 0.06
R2059:2210010C04Rik UTSW 6 41032381 missense probably benign 0.06
R2136:2210010C04Rik UTSW 6 41035462 missense probably benign 0.28
R2446:2210010C04Rik UTSW 6 41031648 missense probably benign 0.15
R5068:2210010C04Rik UTSW 6 41032436 missense probably benign 0.35
R5369:2210010C04Rik UTSW 6 41033006 missense probably benign 0.00
R6392:2210010C04Rik UTSW 6 41032372 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTTTTGAGGTACACGGTCAG -3'
(R):5'- TTGTTGAAAGCGGTGGACAC -3'

Sequencing Primer
(F):5'- AGAGATGGTTAATGTTCTCTCTCC -3'
(R):5'- GCTGGGAAAGTTGTTTCC -3'
Posted On2016-03-17