Incidental Mutation 'R4863:Plcd4'
ID374616
Institutional Source Beutler Lab
Gene Symbol Plcd4
Ensembl Gene ENSMUSG00000026173
Gene Namephospholipase C, delta 4
Synonyms4921507K24Rik
MMRRC Submission 042473-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4863 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location74542888-74567794 bp(+) (GRCm38)
Type of Mutationunclassified (700 bp from exon)
DNA Base Change (assembly) A to G at 74565802 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000065149 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027315] [ENSMUST00000027362] [ENSMUST00000066986] [ENSMUST00000067916] [ENSMUST00000113737] [ENSMUST00000113747] [ENSMUST00000113749] [ENSMUST00000113750] [ENSMUST00000127921] [ENSMUST00000141412] [ENSMUST00000152707] [ENSMUST00000156613]
Predicted Effect probably null
Transcript: ENSMUST00000027315
SMART Domains Protein: ENSMUSP00000027315
Gene: ENSMUSG00000026135

DomainStartEndE-ValueType
ZnF_C2H2 103 127 1.16e1 SMART
ZnF_C2H2 164 186 1.26e-2 SMART
ZnF_C2H2 193 218 7.78e-3 SMART
ZnF_C2H2 223 247 2.29e0 SMART
ZnF_C2H2 250 272 9.96e-1 SMART
low complexity region 317 329 N/A INTRINSIC
ZnF_C2H2 363 385 9.96e-1 SMART
ZnF_C2H2 391 411 1.26e1 SMART
ZnF_C2H2 419 442 1.47e-3 SMART
ZnF_C2H2 453 475 2.75e-3 SMART
ZnF_C2H2 486 511 3.34e-2 SMART
ZnF_C2H2 516 540 4.81e0 SMART
ZnF_C2H2 543 566 7.05e-1 SMART
ZnF_C2H2 572 595 2.17e-1 SMART
ZnF_C2H2 601 623 1.56e-2 SMART
ZnF_C2H2 629 651 8.94e-3 SMART
ZnF_C2H2 657 679 1.38e-3 SMART
ZnF_C2H2 685 707 9.44e-2 SMART
ZnF_C2H2 712 735 1.26e-2 SMART
ZnF_C2H2 744 767 1.31e0 SMART
ZnF_C2H2 773 796 2.63e0 SMART
low complexity region 903 919 N/A INTRINSIC
low complexity region 953 969 N/A INTRINSIC
low complexity region 996 1007 N/A INTRINSIC
ZnF_C2H2 1039 1059 2.01e1 SMART
ZnF_C2H2 1069 1089 1.91e1 SMART
low complexity region 1147 1160 N/A INTRINSIC
ZnF_C2H2 1187 1207 2.7e2 SMART
low complexity region 1209 1222 N/A INTRINSIC
ZnF_C2H2 1265 1285 3.56e1 SMART
ZnF_C2H2 1295 1318 4.98e-1 SMART
ZnF_C2H2 1331 1354 2.49e-1 SMART
ZnF_C2H2 1360 1382 1.03e-2 SMART
ZnF_C2H2 1388 1411 5.72e-1 SMART
ZnF_C2H2 1417 1440 6.75e0 SMART
ZnF_C2H2 1446 1469 9.58e-3 SMART
ZnF_C2H2 1488 1511 1.64e-1 SMART
ZnF_C2H2 1514 1536 1.1e-2 SMART
ZnF_C2H2 1540 1563 4.05e-1 SMART
ZnF_C2H2 1580 1602 4.45e0 SMART
ZnF_C2H2 1608 1630 8.81e-2 SMART
ZnF_C2H2 1636 1658 1.18e-2 SMART
ZnF_C2H2 1664 1686 1.2e-3 SMART
ZnF_C2H2 1692 1715 3.89e-3 SMART
ZnF_C2H2 1721 1743 4.54e-4 SMART
ZnF_C2H2 1749 1771 1.18e-2 SMART
ZnF_C2H2 1777 1799 3.52e-1 SMART
low complexity region 1829 1838 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000027362
SMART Domains Protein: ENSMUSP00000027362
Gene: ENSMUSG00000026173

DomainStartEndE-ValueType
PH 17 126 2.6e-12 SMART
EFh 138 166 9.97e-1 SMART
EFh 174 202 1.83e1 SMART
EFh 207 234 4.45e1 SMART
PLCXc 290 435 2.03e-79 SMART
low complexity region 441 459 N/A INTRINSIC
PLCYc 538 654 1.26e-75 SMART
C2 673 779 5.68e-20 SMART
Predicted Effect probably null
Transcript: ENSMUST00000066986
SMART Domains Protein: ENSMUSP00000065149
Gene: ENSMUSG00000026135

DomainStartEndE-ValueType
low complexity region 116 128 N/A INTRINSIC
ZnF_C2H2 162 184 9.96e-1 SMART
ZnF_C2H2 190 210 1.26e1 SMART
ZnF_C2H2 218 241 1.47e-3 SMART
ZnF_C2H2 252 274 2.75e-3 SMART
ZnF_C2H2 285 310 3.34e-2 SMART
ZnF_C2H2 315 339 4.81e0 SMART
ZnF_C2H2 342 365 7.05e-1 SMART
ZnF_C2H2 371 394 2.17e-1 SMART
ZnF_C2H2 400 422 1.56e-2 SMART
ZnF_C2H2 428 450 8.94e-3 SMART
ZnF_C2H2 456 478 1.38e-3 SMART
ZnF_C2H2 484 506 9.44e-2 SMART
ZnF_C2H2 511 534 1.26e-2 SMART
ZnF_C2H2 543 566 1.31e0 SMART
ZnF_C2H2 572 595 2.63e0 SMART
low complexity region 702 718 N/A INTRINSIC
low complexity region 752 768 N/A INTRINSIC
low complexity region 795 806 N/A INTRINSIC
ZnF_C2H2 838 858 2.01e1 SMART
ZnF_C2H2 868 888 1.91e1 SMART
low complexity region 946 959 N/A INTRINSIC
ZnF_C2H2 986 1006 2.7e2 SMART
low complexity region 1008 1021 N/A INTRINSIC
ZnF_C2H2 1064 1084 3.56e1 SMART
ZnF_C2H2 1094 1117 4.98e-1 SMART
ZnF_C2H2 1130 1153 2.49e-1 SMART
ZnF_C2H2 1159 1181 1.03e-2 SMART
ZnF_C2H2 1187 1210 5.72e-1 SMART
ZnF_C2H2 1216 1239 6.75e0 SMART
ZnF_C2H2 1245 1268 9.58e-3 SMART
ZnF_C2H2 1287 1310 1.64e-1 SMART
ZnF_C2H2 1313 1335 1.1e-2 SMART
ZnF_C2H2 1339 1362 4.05e-1 SMART
ZnF_C2H2 1379 1401 4.45e0 SMART
ZnF_C2H2 1407 1429 8.81e-2 SMART
ZnF_C2H2 1435 1457 1.18e-2 SMART
ZnF_C2H2 1463 1485 1.2e-3 SMART
ZnF_C2H2 1491 1514 3.89e-3 SMART
ZnF_C2H2 1520 1542 4.54e-4 SMART
ZnF_C2H2 1548 1570 1.18e-2 SMART
ZnF_C2H2 1576 1598 3.52e-1 SMART
low complexity region 1628 1637 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000067916
SMART Domains Protein: ENSMUSP00000064413
Gene: ENSMUSG00000026173

DomainStartEndE-ValueType
PH 17 126 2.6e-12 SMART
EFh 138 166 9.97e-1 SMART
EFh 174 202 1.83e1 SMART
EFh 207 234 4.45e1 SMART
PLCXc 290 435 2.03e-79 SMART
low complexity region 441 459 N/A INTRINSIC
PLCYc 506 622 1.26e-75 SMART
C2 641 747 5.68e-20 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000113737
SMART Domains Protein: ENSMUSP00000109366
Gene: ENSMUSG00000026135

DomainStartEndE-ValueType
ZnF_C2H2 93 115 9.81e1 SMART
ZnF_C2H2 120 144 2.29e0 SMART
ZnF_C2H2 147 169 9.96e-1 SMART
low complexity region 214 226 N/A INTRINSIC
ZnF_C2H2 260 282 9.96e-1 SMART
ZnF_C2H2 288 308 1.26e1 SMART
ZnF_C2H2 316 339 1.47e-3 SMART
ZnF_C2H2 350 372 2.75e-3 SMART
ZnF_C2H2 383 408 3.34e-2 SMART
ZnF_C2H2 413 437 4.81e0 SMART
ZnF_C2H2 440 463 7.05e-1 SMART
ZnF_C2H2 469 492 2.17e-1 SMART
ZnF_C2H2 498 520 1.56e-2 SMART
ZnF_C2H2 526 548 8.94e-3 SMART
ZnF_C2H2 554 576 1.38e-3 SMART
ZnF_C2H2 582 604 9.44e-2 SMART
ZnF_C2H2 609 632 1.26e-2 SMART
ZnF_C2H2 641 664 1.31e0 SMART
ZnF_C2H2 670 693 2.63e0 SMART
low complexity region 800 816 N/A INTRINSIC
low complexity region 850 866 N/A INTRINSIC
low complexity region 893 904 N/A INTRINSIC
ZnF_C2H2 936 956 2.01e1 SMART
ZnF_C2H2 966 986 1.91e1 SMART
low complexity region 1044 1057 N/A INTRINSIC
ZnF_C2H2 1084 1104 2.7e2 SMART
low complexity region 1106 1119 N/A INTRINSIC
ZnF_C2H2 1162 1182 3.56e1 SMART
ZnF_C2H2 1192 1215 4.98e-1 SMART
ZnF_C2H2 1228 1251 2.49e-1 SMART
ZnF_C2H2 1257 1279 1.03e-2 SMART
ZnF_C2H2 1285 1308 5.72e-1 SMART
ZnF_C2H2 1314 1337 6.75e0 SMART
ZnF_C2H2 1343 1366 9.58e-3 SMART
ZnF_C2H2 1385 1408 1.64e-1 SMART
ZnF_C2H2 1411 1433 1.1e-2 SMART
ZnF_C2H2 1437 1460 4.05e-1 SMART
ZnF_C2H2 1477 1499 4.45e0 SMART
ZnF_C2H2 1505 1527 8.81e-2 SMART
ZnF_C2H2 1533 1555 1.18e-2 SMART
ZnF_C2H2 1561 1583 1.2e-3 SMART
ZnF_C2H2 1589 1612 3.89e-3 SMART
ZnF_C2H2 1618 1640 4.54e-4 SMART
ZnF_C2H2 1646 1668 1.18e-2 SMART
ZnF_C2H2 1674 1696 3.52e-1 SMART
low complexity region 1726 1735 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000113747
SMART Domains Protein: ENSMUSP00000109376
Gene: ENSMUSG00000026173

DomainStartEndE-ValueType
PH 17 126 2.6e-12 SMART
EFh 138 166 9.97e-1 SMART
EFh 174 202 1.83e1 SMART
EFh 207 234 4.45e1 SMART
PLCXc 290 435 2.03e-79 SMART
low complexity region 441 459 N/A INTRINSIC
PLCYc 506 622 1.26e-75 SMART
C2 641 747 5.68e-20 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000113749
SMART Domains Protein: ENSMUSP00000109378
Gene: ENSMUSG00000026173

DomainStartEndE-ValueType
PH 17 126 2.6e-12 SMART
EFh 138 166 9.97e-1 SMART
EFh 174 202 1.83e1 SMART
EFh 207 234 4.45e1 SMART
PLCXc 290 435 2.03e-79 SMART
low complexity region 441 459 N/A INTRINSIC
PLCYc 538 654 1.26e-75 SMART
C2 673 779 5.68e-20 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000113750
AA Change: Y786C

PolyPhen 2 Score 0.306 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000109379
Gene: ENSMUSG00000026173
AA Change: Y786C

DomainStartEndE-ValueType
PH 17 126 2.6e-12 SMART
EFh 138 166 9.97e-1 SMART
EFh 174 202 1.83e1 SMART
EFh 207 234 4.45e1 SMART
PLCXc 290 435 2.03e-79 SMART
low complexity region 441 459 N/A INTRINSIC
PLCYc 506 622 1.26e-75 SMART
C2 641 747 7.16e-17 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000127921
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135111
Predicted Effect probably benign
Transcript: ENSMUST00000141412
SMART Domains Protein: ENSMUSP00000115322
Gene: ENSMUSG00000026173

DomainStartEndE-ValueType
PH 17 126 2.6e-12 SMART
EFh 138 166 9.97e-1 SMART
EFh 174 202 1.83e1 SMART
EFh 207 234 4.45e1 SMART
PLCXc 290 435 2.03e-79 SMART
low complexity region 441 459 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000152707
SMART Domains Protein: ENSMUSP00000121732
Gene: ENSMUSG00000026173

DomainStartEndE-ValueType
PH 17 126 2.6e-12 SMART
EFh 138 166 9.97e-1 SMART
EFh 174 202 1.83e1 SMART
EFh 207 234 4.45e1 SMART
PLCXc 290 435 2.03e-79 SMART
low complexity region 441 459 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000156613
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189956
Meta Mutation Damage Score 0.6204 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency 99% (105/106)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the delta class of phospholipase C enzymes. Phospholipase C enzymes play a critical role in many cellular processes by hydrolyzing phosphatidylinositol 4,5-bisphosphate into two intracellular second messengers, inositol 1,4,5-trisphosphate and diacylglycerol. Expression of this gene may be a marker for cancer. [provided by RefSeq, Jan 2011]
PHENOTYPE: Males homozygous for a targeted null mutation are subfertile or sterile. Sperm from mutant males fail to initiate the acrosome reaction. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 98 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210407C18Rik A T 11: 58,612,512 probably null Het
4930578I06Rik C T 14: 63,973,209 R190H probably benign Het
A530032D15Rik C T 1: 85,088,800 probably benign Het
Abcc12 T A 8: 86,538,376 I647F probably damaging Het
Acnat2 C A 4: 49,380,172 W384L probably damaging Het
Acvr1 A G 2: 58,477,711 L146P possibly damaging Het
Ankrd16 T A 2: 11,784,316 M238K probably benign Het
BC005561 A T 5: 104,517,750 D46V possibly damaging Het
Cd3eap T A 7: 19,357,759 Q141L probably damaging Het
Clmn A T 12: 104,797,094 I91N probably damaging Het
Cog8 A T 8: 107,050,174 L523H probably damaging Het
Cpxm2 T A 7: 132,059,747 K437M probably benign Het
Dhx57 A T 17: 80,253,111 V999E probably damaging Het
Dnpep T C 1: 75,309,230 probably benign Het
Dok3 G A 13: 55,523,457 R434W probably damaging Het
Dpysl5 C T 5: 30,784,343 H275Y probably benign Het
Ednra A T 8: 77,667,383 N361K probably damaging Het
Ei24 A T 9: 36,784,565 S210R probably damaging Het
Erich3 T A 3: 154,764,804 V158E unknown Het
Fam193a T A 5: 34,466,205 V1379E possibly damaging Het
Fasn A G 11: 120,808,828 V2304A probably damaging Het
Fcgbp A C 7: 28,086,344 D402A probably benign Het
Fkbp14 T C 6: 54,585,945 probably benign Het
Fnip1 G A 11: 54,515,556 V1160I possibly damaging Het
Fsd2 T C 7: 81,552,964 K289R probably null Het
Fuca2 A T 10: 13,505,907 D188V probably damaging Het
Gfpt2 T C 11: 49,810,970 V116A probably benign Het
Gm10770 T A 2: 150,178,896 K234* probably null Het
Gm9887 A G 12: 69,371,989 probably benign Het
Gtf3c2 A G 5: 31,159,233 probably benign Het
H2-M10.3 T C 17: 36,366,636 D250G probably damaging Het
Hapln4 G A 8: 70,084,492 V26M possibly damaging Het
Hook3 G A 8: 26,038,029 A611V probably damaging Het
Hr T C 14: 70,571,972 L1141P probably damaging Het
Ifngr1 T C 10: 19,609,416 S388P probably damaging Het
Itga3 T A 11: 95,061,967 Q326L probably damaging Het
Itgb3 T A 11: 104,665,520 I729N probably damaging Het
Kcnab2 A G 4: 152,401,946 S132P probably damaging Het
Lama3 C T 18: 12,539,793 A2481V probably damaging Het
Lama3 T C 18: 12,498,678 probably benign Het
Lce1e A T 3: 92,707,871 C56* probably null Het
Lmcd1 T C 6: 112,287,871 probably benign Het
Lrrc14 T A 15: 76,713,362 probably null Het
Map4k5 G A 12: 69,818,438 P591L probably benign Het
Mapk13 C A 17: 28,776,310 D168E probably damaging Het
Marf1 A C 16: 14,132,665 H952Q possibly damaging Het
Megf6 T C 4: 154,254,281 probably null Het
Mical3 T C 6: 121,033,787 I411M probably damaging Het
Myo5a A T 9: 75,217,507 K1781N probably damaging Het
N4bp2 T C 5: 65,808,130 V1174A probably benign Het
Ncdn A T 4: 126,750,423 L202Q probably damaging Het
Ncor1 T A 11: 62,392,638 M408L possibly damaging Het
Nf1 T C 11: 79,409,409 L249P probably damaging Het
Nlrp9b T A 7: 20,049,596 probably null Het
Nxpe3 A T 16: 55,849,633 Y370N probably damaging Het
P2rx2 T A 5: 110,341,568 T167S probably benign Het
Pcdhb19 G T 18: 37,499,108 R652L probably benign Het
Pcdhga12 T C 18: 37,768,281 L722P probably benign Het
Pde6a A T 18: 61,245,592 I329F probably damaging Het
Pdpr T A 8: 111,101,951 S29T probably benign Het
Pfkfb3 T C 2: 11,486,312 D173G probably benign Het
Pou2f2 A G 7: 25,097,108 probably benign Het
Ppp1r14c TGGCGGCGGCGGCGGCGG TGGCGGCGGCGGCGG 10: 3,366,702 probably benign Het
Ppp1r42 T C 1: 10,003,386 probably benign Het
Ptpre C T 7: 135,669,132 H346Y probably benign Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Rab12 A T 17: 66,498,108 Y142N probably damaging Het
Rai14 A C 15: 10,572,470 M857R probably damaging Het
Ranbp2 A G 10: 58,492,421 K2753R probably damaging Het
Rasa4 A T 5: 136,103,911 K6* probably null Het
Rasgef1a A G 6: 118,089,139 M438V probably benign Het
Recql T G 6: 142,359,006 probably benign Het
Rftn2 A G 1: 55,172,039 V425A probably benign Het
Ror1 A G 4: 100,409,804 Y234C probably damaging Het
Sap30l T A 11: 57,806,054 L70Q probably damaging Het
Scn4a T C 11: 106,320,002 R1730G probably damaging Het
Serinc5 T G 13: 92,690,980 I268R probably damaging Het
Sin3b G A 8: 72,744,948 V432I possibly damaging Het
Slc30a6 T C 17: 74,412,654 M203T possibly damaging Het
Soat1 T C 1: 156,432,328 N481S probably damaging Het
Sos2 G A 12: 69,640,154 T206I probably benign Het
Sp100 G T 1: 85,705,003 A132S probably benign Het
Spata31d1c T A 13: 65,035,790 L382* probably null Het
Stard9 T A 2: 120,700,860 W2533R probably benign Het
Tas2r126 A G 6: 42,435,390 T286A probably benign Het
Tedc2 T A 17: 24,217,936 K275M probably damaging Het
Ten1 A T 11: 116,218,231 K242N probably benign Het
Tial1 C T 7: 128,455,028 V1I probably damaging Het
Tle2 G A 10: 81,588,891 R649H possibly damaging Het
Tmem178 A G 17: 80,944,945 D86G probably benign Het
Trim29 T A 9: 43,329,575 D528E possibly damaging Het
Vmn2r61 A T 7: 42,300,708 T851S probably benign Het
Vmn2r72 T A 7: 85,750,598 Q414H possibly damaging Het
Yars A T 4: 129,189,882 probably benign Het
Yipf4 A G 17: 74,494,092 Q135R probably damaging Het
Zfp341 G A 2: 154,645,866 probably benign Het
Zfp426 T C 9: 20,470,038 Y536C probably damaging Het
Zp2 T G 7: 120,135,772 Y430S probably damaging Het
Other mutations in Plcd4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00489:Plcd4 APN 1 74552115 missense probably damaging 1.00
IGL01806:Plcd4 APN 1 74552033 missense probably benign 0.42
IGL02537:Plcd4 APN 1 74556050 missense possibly damaging 0.55
IGL02574:Plcd4 APN 1 74564380 missense probably damaging 1.00
IGL02812:Plcd4 APN 1 74557808 missense probably damaging 1.00
IGL03350:Plcd4 APN 1 74549301 missense probably damaging 1.00
R0415:Plcd4 UTSW 1 74552097 missense probably damaging 0.99
R1699:Plcd4 UTSW 1 74548235 missense probably benign 0.01
R1852:Plcd4 UTSW 1 74549361 missense possibly damaging 0.92
R2120:Plcd4 UTSW 1 74564425 missense probably benign 0.00
R2125:Plcd4 UTSW 1 74565152 missense probably damaging 1.00
R3023:Plcd4 UTSW 1 74548192 missense probably damaging 1.00
R3157:Plcd4 UTSW 1 74551154 splice site probably null
R4535:Plcd4 UTSW 1 74563468 missense probably damaging 1.00
R4581:Plcd4 UTSW 1 74548224 missense probably damaging 1.00
R4911:Plcd4 UTSW 1 74564413 missense possibly damaging 0.78
R4987:Plcd4 UTSW 1 74547959 unclassified probably benign
R5102:Plcd4 UTSW 1 74565154 missense probably damaging 1.00
R5752:Plcd4 UTSW 1 74547972 splice site probably null
R5887:Plcd4 UTSW 1 74551090 missense probably damaging 1.00
R6318:Plcd4 UTSW 1 74563594 missense possibly damaging 0.61
R6648:Plcd4 UTSW 1 74552013 missense probably benign 0.00
R6796:Plcd4 UTSW 1 74562070 missense probably benign 0.03
R6920:Plcd4 UTSW 1 74565835 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- GGTACTAAATTGCCTTGTCCCC -3'
(R):5'- GCCAAATCGGACAGAGAAGC -3'

Sequencing Primer
(F):5'- AGACACCGTCTTACTATGTAGCCTAG -3'
(R):5'- TCGGACAGAGAAGCTCTATTTAGACC -3'
Posted On2016-03-17