Incidental Mutation 'R4863:Fcgbp'
ID374652
Institutional Source Beutler Lab
Gene Symbol Fcgbp
Ensembl Gene ENSMUSG00000047730
Gene NameFc fragment of IgG binding protein
SynonymsA430096B05Rik
MMRRC Submission 042473-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.294) question?
Stock #R4863 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location28071236-28120862 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 28086344 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Alanine at position 402 (D402A)
Ref Sequence ENSEMBL: ENSMUSP00000114271 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076648] [ENSMUST00000138392]
Predicted Effect probably benign
Transcript: ENSMUST00000076648
AA Change: D402A

PolyPhen 2 Score 0.296 (Sensitivity: 0.91; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000075945
Gene: ENSMUSG00000047730
AA Change: D402A

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
FOLN 27 49 2.3e-4 SMART
VWD 46 211 5.26e-45 SMART
low complexity region 226 237 N/A INTRINSIC
C8 251 326 1.17e-34 SMART
Pfam:TIL 329 383 1.2e-12 PFAM
VWC 385 431 2.34e-1 SMART
FOLN 418 441 3.48e1 SMART
VWD 438 603 6.85e-35 SMART
C8 642 717 1.4e-32 SMART
Pfam:TIL 720 773 4.7e-14 PFAM
VWC 775 829 9.42e-1 SMART
VWD 824 990 7.86e-44 SMART
C8 1034 1109 1.66e-34 SMART
Pfam:TIL 1112 1165 6.7e-13 PFAM
VWC 1167 1225 9.8e-3 SMART
FOLN 1198 1220 9.55e-1 SMART
FOLN 1224 1246 2.41e0 SMART
VWD 1243 1411 6.59e-37 SMART
C8 1451 1527 5.6e-32 SMART
low complexity region 1541 1551 N/A INTRINSIC
EGF_like 1558 1581 6.15e1 SMART
VWC 1589 1682 1.6e-2 SMART
VWD 1640 1807 5.15e-39 SMART
C8 1839 1914 4.62e-33 SMART
EGF_like 1942 1965 4.46e1 SMART
VWC 1972 2064 1.92e-1 SMART
VWD 2024 2180 6.34e-39 SMART
low complexity region 2201 2214 N/A INTRINSIC
C8 2221 2296 3.7e-32 SMART
Pfam:TIL 2299 2352 5e-12 PFAM
VWC 2354 2413 8.29e-1 SMART
FOLN 2385 2407 4.96e1 SMART
VWD 2404 2566 1.89e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000138392
AA Change: D402A

PolyPhen 2 Score 0.329 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000114271
Gene: ENSMUSG00000047730
AA Change: D402A

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
FOLN 27 49 2.3e-4 SMART
VWD 46 211 5.26e-45 SMART
low complexity region 226 237 N/A INTRINSIC
C8 251 326 1.17e-34 SMART
Pfam:TIL 329 383 8.4e-13 PFAM
VWC 385 431 2.34e-1 SMART
FOLN 418 441 3.48e1 SMART
VWD 438 603 7.99e-36 SMART
C8 642 717 1.4e-32 SMART
Pfam:TIL 720 773 3.3e-14 PFAM
VWC 775 829 9.42e-1 SMART
VWD 824 990 7.86e-44 SMART
C8 1034 1109 1.66e-34 SMART
Pfam:TIL 1112 1165 6.9e-13 PFAM
VWC 1167 1225 9.8e-3 SMART
FOLN 1198 1220 9.55e-1 SMART
FOLN 1224 1246 2.41e0 SMART
VWD 1243 1411 6.59e-37 SMART
C8 1451 1527 5.6e-32 SMART
low complexity region 1541 1551 N/A INTRINSIC
EGF_like 1558 1581 6.15e1 SMART
VWC 1589 1682 1.6e-2 SMART
VWD 1640 1807 5.15e-39 SMART
C8 1839 1914 4.62e-33 SMART
EGF_like 1942 1965 4.46e1 SMART
VWC 1972 2064 1.92e-1 SMART
VWD 2024 2180 6.34e-39 SMART
low complexity region 2201 2214 N/A INTRINSIC
C8 2221 2296 3.7e-32 SMART
Pfam:TIL 2299 2352 1e-11 PFAM
VWC 2354 2413 8.29e-1 SMART
FOLN 2385 2407 4.96e1 SMART
VWD 2404 2566 1.89e-5 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140004
Meta Mutation Damage Score 0.1268 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency 99% (105/106)
Allele List at MGI
Other mutations in this stock
Total: 98 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210407C18Rik A T 11: 58,612,512 probably null Het
4930578I06Rik C T 14: 63,973,209 R190H probably benign Het
A530032D15Rik C T 1: 85,088,800 probably benign Het
Abcc12 T A 8: 86,538,376 I647F probably damaging Het
Acnat2 C A 4: 49,380,172 W384L probably damaging Het
Acvr1 A G 2: 58,477,711 L146P possibly damaging Het
Ankrd16 T A 2: 11,784,316 M238K probably benign Het
BC005561 A T 5: 104,517,750 D46V possibly damaging Het
Cd3eap T A 7: 19,357,759 Q141L probably damaging Het
Clmn A T 12: 104,797,094 I91N probably damaging Het
Cog8 A T 8: 107,050,174 L523H probably damaging Het
Cpxm2 T A 7: 132,059,747 K437M probably benign Het
Dhx57 A T 17: 80,253,111 V999E probably damaging Het
Dnpep T C 1: 75,309,230 probably benign Het
Dok3 G A 13: 55,523,457 R434W probably damaging Het
Dpysl5 C T 5: 30,784,343 H275Y probably benign Het
Ednra A T 8: 77,667,383 N361K probably damaging Het
Ei24 A T 9: 36,784,565 S210R probably damaging Het
Erich3 T A 3: 154,764,804 V158E unknown Het
Fam193a T A 5: 34,466,205 V1379E possibly damaging Het
Fasn A G 11: 120,808,828 V2304A probably damaging Het
Fkbp14 T C 6: 54,585,945 probably benign Het
Fnip1 G A 11: 54,515,556 V1160I possibly damaging Het
Fsd2 T C 7: 81,552,964 K289R probably null Het
Fuca2 A T 10: 13,505,907 D188V probably damaging Het
Gfpt2 T C 11: 49,810,970 V116A probably benign Het
Gm10770 T A 2: 150,178,896 K234* probably null Het
Gm9887 A G 12: 69,371,989 probably benign Het
Gtf3c2 A G 5: 31,159,233 probably benign Het
H2-M10.3 T C 17: 36,366,636 D250G probably damaging Het
Hapln4 G A 8: 70,084,492 V26M possibly damaging Het
Hook3 G A 8: 26,038,029 A611V probably damaging Het
Hr T C 14: 70,571,972 L1141P probably damaging Het
Ifngr1 T C 10: 19,609,416 S388P probably damaging Het
Itga3 T A 11: 95,061,967 Q326L probably damaging Het
Itgb3 T A 11: 104,665,520 I729N probably damaging Het
Kcnab2 A G 4: 152,401,946 S132P probably damaging Het
Lama3 C T 18: 12,539,793 A2481V probably damaging Het
Lama3 T C 18: 12,498,678 probably benign Het
Lce1e A T 3: 92,707,871 C56* probably null Het
Lmcd1 T C 6: 112,287,871 probably benign Het
Lrrc14 T A 15: 76,713,362 probably null Het
Map4k5 G A 12: 69,818,438 P591L probably benign Het
Mapk13 C A 17: 28,776,310 D168E probably damaging Het
Marf1 A C 16: 14,132,665 H952Q possibly damaging Het
Megf6 T C 4: 154,254,281 probably null Het
Mical3 T C 6: 121,033,787 I411M probably damaging Het
Myo5a A T 9: 75,217,507 K1781N probably damaging Het
N4bp2 T C 5: 65,808,130 V1174A probably benign Het
Ncdn A T 4: 126,750,423 L202Q probably damaging Het
Ncor1 T A 11: 62,392,638 M408L possibly damaging Het
Nf1 T C 11: 79,409,409 L249P probably damaging Het
Nlrp9b T A 7: 20,049,596 probably null Het
Nxpe3 A T 16: 55,849,633 Y370N probably damaging Het
P2rx2 T A 5: 110,341,568 T167S probably benign Het
Pcdhb19 G T 18: 37,499,108 R652L probably benign Het
Pcdhga12 T C 18: 37,768,281 L722P probably benign Het
Pde6a A T 18: 61,245,592 I329F probably damaging Het
Pdpr T A 8: 111,101,951 S29T probably benign Het
Pfkfb3 T C 2: 11,486,312 D173G probably benign Het
Plcd4 A G 1: 74,565,802 probably null Het
Pou2f2 A G 7: 25,097,108 probably benign Het
Ppp1r14c TGGCGGCGGCGGCGGCGG TGGCGGCGGCGGCGG 10: 3,366,702 probably benign Het
Ppp1r42 T C 1: 10,003,386 probably benign Het
Ptpre C T 7: 135,669,132 H346Y probably benign Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Rab12 A T 17: 66,498,108 Y142N probably damaging Het
Rai14 A C 15: 10,572,470 M857R probably damaging Het
Ranbp2 A G 10: 58,492,421 K2753R probably damaging Het
Rasa4 A T 5: 136,103,911 K6* probably null Het
Rasgef1a A G 6: 118,089,139 M438V probably benign Het
Recql T G 6: 142,359,006 probably benign Het
Rftn2 A G 1: 55,172,039 V425A probably benign Het
Ror1 A G 4: 100,409,804 Y234C probably damaging Het
Sap30l T A 11: 57,806,054 L70Q probably damaging Het
Scn4a T C 11: 106,320,002 R1730G probably damaging Het
Serinc5 T G 13: 92,690,980 I268R probably damaging Het
Sin3b G A 8: 72,744,948 V432I possibly damaging Het
Slc30a6 T C 17: 74,412,654 M203T possibly damaging Het
Soat1 T C 1: 156,432,328 N481S probably damaging Het
Sos2 G A 12: 69,640,154 T206I probably benign Het
Sp100 G T 1: 85,705,003 A132S probably benign Het
Spata31d1c T A 13: 65,035,790 L382* probably null Het
Stard9 T A 2: 120,700,860 W2533R probably benign Het
Tas2r126 A G 6: 42,435,390 T286A probably benign Het
Tedc2 T A 17: 24,217,936 K275M probably damaging Het
Ten1 A T 11: 116,218,231 K242N probably benign Het
Tial1 C T 7: 128,455,028 V1I probably damaging Het
Tle2 G A 10: 81,588,891 R649H possibly damaging Het
Tmem178 A G 17: 80,944,945 D86G probably benign Het
Trim29 T A 9: 43,329,575 D528E possibly damaging Het
Vmn2r61 A T 7: 42,300,708 T851S probably benign Het
Vmn2r72 T A 7: 85,750,598 Q414H possibly damaging Het
Yars A T 4: 129,189,882 probably benign Het
Yipf4 A G 17: 74,494,092 Q135R probably damaging Het
Zfp341 G A 2: 154,645,866 probably benign Het
Zfp426 T C 9: 20,470,038 Y536C probably damaging Het
Zp2 T G 7: 120,135,772 Y430S probably damaging Het
Other mutations in Fcgbp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00309:Fcgbp APN 7 28085130 missense probably damaging 1.00
IGL00331:Fcgbp APN 7 28101541 splice site probably benign
IGL00335:Fcgbp APN 7 28086135 missense possibly damaging 0.90
IGL00470:Fcgbp APN 7 28075086 nonsense probably null
IGL00491:Fcgbp APN 7 28093402 missense probably damaging 1.00
IGL00498:Fcgbp APN 7 28091797 missense probably damaging 1.00
IGL01296:Fcgbp APN 7 28089647 missense probably benign 0.15
IGL01582:Fcgbp APN 7 28093642 missense probably benign 0.19
IGL01929:Fcgbp APN 7 28103963 missense probably damaging 1.00
IGL02024:Fcgbp APN 7 28106374 missense probably damaging 1.00
IGL02027:Fcgbp APN 7 28075204 missense probably damaging 1.00
IGL02140:Fcgbp APN 7 28091954 missense probably damaging 1.00
IGL02162:Fcgbp APN 7 28075235 missense probably damaging 1.00
IGL02345:Fcgbp APN 7 28071643 splice site probably benign
IGL02377:Fcgbp APN 7 28106970 missense possibly damaging 0.67
IGL02389:Fcgbp APN 7 28075171 missense probably damaging 1.00
IGL02423:Fcgbp APN 7 28089953 missense probably benign 0.02
IGL02523:Fcgbp APN 7 28104732 missense possibly damaging 0.89
IGL02561:Fcgbp APN 7 28101174 intron probably benign
IGL02631:Fcgbp APN 7 28085298 missense probably damaging 1.00
IGL02716:Fcgbp APN 7 28101434 missense probably damaging 0.98
IGL02836:Fcgbp APN 7 28117358 missense possibly damaging 0.91
IGL02957:Fcgbp APN 7 28091847 nonsense probably null
IGL02971:Fcgbp APN 7 28101473 missense probably damaging 1.00
IGL03284:Fcgbp APN 7 28085432 missense possibly damaging 0.93
IGL03379:Fcgbp APN 7 28089917 missense possibly damaging 0.76
IGL02796:Fcgbp UTSW 7 28101151 intron probably benign
R0277:Fcgbp UTSW 7 28085493 critical splice donor site probably null
R0387:Fcgbp UTSW 7 28091454 splice site probably benign
R0586:Fcgbp UTSW 7 28089713 missense probably damaging 1.00
R0981:Fcgbp UTSW 7 28085110 nonsense probably null
R0987:Fcgbp UTSW 7 28094174 missense probably damaging 1.00
R1240:Fcgbp UTSW 7 28120525 missense probably damaging 1.00
R1394:Fcgbp UTSW 7 28093379 missense probably damaging 0.98
R1395:Fcgbp UTSW 7 28093379 missense probably damaging 0.98
R1438:Fcgbp UTSW 7 28103733 nonsense probably null
R1474:Fcgbp UTSW 7 28091848 missense probably benign 0.00
R1521:Fcgbp UTSW 7 28075160 missense probably benign 0.00
R1740:Fcgbp UTSW 7 28101249 missense possibly damaging 0.87
R1750:Fcgbp UTSW 7 28093443 nonsense probably null
R1772:Fcgbp UTSW 7 28105175 missense possibly damaging 0.90
R1804:Fcgbp UTSW 7 28086139 missense probably benign
R1808:Fcgbp UTSW 7 28085090 missense probably benign 0.04
R1819:Fcgbp UTSW 7 28085283 missense probably benign 0.00
R1934:Fcgbp UTSW 7 28107093 missense probably damaging 1.00
R1972:Fcgbp UTSW 7 28094192 missense probably benign 0.11
R2051:Fcgbp UTSW 7 28120360 missense probably damaging 0.97
R2072:Fcgbp UTSW 7 28120389 missense probably damaging 0.98
R2074:Fcgbp UTSW 7 28120389 missense probably damaging 0.98
R2124:Fcgbp UTSW 7 28092019 missense probably benign 0.03
R2155:Fcgbp UTSW 7 28107203 missense probably benign 0.00
R3015:Fcgbp UTSW 7 28075413 splice site probably benign
R3037:Fcgbp UTSW 7 28102702 missense possibly damaging 0.62
R3151:Fcgbp UTSW 7 28117240 missense probably damaging 1.00
R3176:Fcgbp UTSW 7 28091661 missense probably damaging 0.99
R3177:Fcgbp UTSW 7 28091661 missense probably damaging 0.99
R3276:Fcgbp UTSW 7 28091661 missense probably damaging 0.99
R3277:Fcgbp UTSW 7 28091661 missense probably damaging 0.99
R3623:Fcgbp UTSW 7 28101276 missense probably damaging 1.00
R3730:Fcgbp UTSW 7 28085457 missense possibly damaging 0.82
R3935:Fcgbp UTSW 7 28075399 missense probably benign 0.00
R3936:Fcgbp UTSW 7 28075399 missense probably benign 0.00
R4041:Fcgbp UTSW 7 28113979 missense probably benign 0.01
R4056:Fcgbp UTSW 7 28104116 missense probably benign 0.09
R4057:Fcgbp UTSW 7 28104116 missense probably benign 0.09
R4705:Fcgbp UTSW 7 28107296 missense probably benign 0.44
R4708:Fcgbp UTSW 7 28094961 missense probably benign 0.00
R4710:Fcgbp UTSW 7 28094961 missense probably benign 0.00
R4779:Fcgbp UTSW 7 28094937 missense probably damaging 1.00
R4820:Fcgbp UTSW 7 28113958 missense probably damaging 1.00
R4926:Fcgbp UTSW 7 28086235 missense probably damaging 0.99
R4947:Fcgbp UTSW 7 28089812 missense probably benign 0.00
R4979:Fcgbp UTSW 7 28117570 missense probably benign 0.06
R5002:Fcgbp UTSW 7 28086103 splice site probably null
R5219:Fcgbp UTSW 7 28104085 missense probably damaging 1.00
R5241:Fcgbp UTSW 7 28085199 missense probably damaging 1.00
R5301:Fcgbp UTSW 7 28093674 missense possibly damaging 0.93
R5306:Fcgbp UTSW 7 28091818 missense probably damaging 1.00
R5335:Fcgbp UTSW 7 28089734 missense probably damaging 1.00
R5399:Fcgbp UTSW 7 28105055 missense probably benign 0.05
R5418:Fcgbp UTSW 7 28085313 missense probably damaging 1.00
R5527:Fcgbp UTSW 7 28093635 missense probably benign
R5583:Fcgbp UTSW 7 28091579 missense probably damaging 1.00
R5698:Fcgbp UTSW 7 28092022 missense possibly damaging 0.95
R5780:Fcgbp UTSW 7 28085218 missense probably benign 0.02
R5813:Fcgbp UTSW 7 28101494 missense possibly damaging 0.64
R5910:Fcgbp UTSW 7 28085503 splice site probably benign
R5936:Fcgbp UTSW 7 28086692 missense probably damaging 0.98
R5992:Fcgbp UTSW 7 28120534 missense probably benign 0.05
R6091:Fcgbp UTSW 7 28104965 missense possibly damaging 0.90
R6372:Fcgbp UTSW 7 28107008 missense probably damaging 1.00
R6488:Fcgbp UTSW 7 28093538 missense probably damaging 0.96
R6548:Fcgbp UTSW 7 28091918 missense probably benign 0.00
R6553:Fcgbp UTSW 7 28113979 missense possibly damaging 0.79
R6585:Fcgbp UTSW 7 28113979 missense possibly damaging 0.79
R6695:Fcgbp UTSW 7 28086270 nonsense probably null
R6711:Fcgbp UTSW 7 28089673 missense probably damaging 0.99
R6803:Fcgbp UTSW 7 28103212 missense probably benign 0.00
R6822:Fcgbp UTSW 7 28107356 missense probably damaging 1.00
R6907:Fcgbp UTSW 7 28085018 missense probably damaging 1.00
R6912:Fcgbp UTSW 7 28089704 missense probably benign 0.15
R6924:Fcgbp UTSW 7 28093823 missense probably benign
R6943:Fcgbp UTSW 7 28092052 missense probably benign 0.22
X0028:Fcgbp UTSW 7 28104020 missense possibly damaging 0.48
Predicted Primers PCR Primer
(F):5'- ACAGCTGCTATGATCCTTGC -3'
(R):5'- GTCAAAGCGCTTTCCATCGAAG -3'

Sequencing Primer
(F):5'- GCTATGATCCTTGCAGCCCTG -3'
(R):5'- TCGAAGCTCACATAGTGCG -3'
Posted On2016-03-17