Incidental Mutation 'R4863:Zp2'
ID374656
Institutional Source Beutler Lab
Gene Symbol Zp2
Ensembl Gene ENSMUSG00000030911
Gene Namezona pellucida glycoprotein 2
SynonymsZp-2
MMRRC Submission 042473-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.089) question?
Stock #R4863 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location120126772-120145291 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 120135772 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Serine at position 430 (Y430S)
Ref Sequence ENSEMBL: ENSMUSP00000147097 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033207] [ENSMUST00000207726] [ENSMUST00000208874]
Predicted Effect probably damaging
Transcript: ENSMUST00000033207
AA Change: Y430S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000033207
Gene: ENSMUSG00000030911
AA Change: Y430S

DomainStartEndE-ValueType
signal peptide 1 34 N/A INTRINSIC
ZP 364 630 1.06e-86 SMART
low complexity region 655 668 N/A INTRINSIC
transmembrane domain 684 703 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207333
Predicted Effect probably benign
Transcript: ENSMUST00000207726
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208122
Predicted Effect probably damaging
Transcript: ENSMUST00000208874
AA Change: Y430S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.264 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency 99% (105/106)
MGI Phenotype FUNCTION: This gene encodes a member of the zona pellucida family of glycoproteins that play an important role in the survival of growing oocytes, successful fertilization and the passage of early embryos through the oviduct. The encoded preproprotein undergoes proteolytic processing to generate the mature polypeptide that is incorporated into the extracellular matrix surrounding mouse oocytes. Mice lacking the encoded protein develop defective zonae pellucidae that disrupt folliculogenesis, fertility and development. [provided by RefSeq, Sep 2016]
PHENOTYPE: Female homozygous mutants exhibit a thin zona pellucida matrix in early ovarian follicles that becomes disassociated in pre-ovulatory follicles. Few oocytes are produced, and any that are fertilized fail to survive to the two-cell stage. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 98 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210407C18Rik A T 11: 58,612,512 probably null Het
4930578I06Rik C T 14: 63,973,209 R190H probably benign Het
A530032D15Rik C T 1: 85,088,800 probably benign Het
Abcc12 T A 8: 86,538,376 I647F probably damaging Het
Acnat2 C A 4: 49,380,172 W384L probably damaging Het
Acvr1 A G 2: 58,477,711 L146P possibly damaging Het
Ankrd16 T A 2: 11,784,316 M238K probably benign Het
BC005561 A T 5: 104,517,750 D46V possibly damaging Het
Cd3eap T A 7: 19,357,759 Q141L probably damaging Het
Clmn A T 12: 104,797,094 I91N probably damaging Het
Cog8 A T 8: 107,050,174 L523H probably damaging Het
Cpxm2 T A 7: 132,059,747 K437M probably benign Het
Dhx57 A T 17: 80,253,111 V999E probably damaging Het
Dnpep T C 1: 75,309,230 probably benign Het
Dok3 G A 13: 55,523,457 R434W probably damaging Het
Dpysl5 C T 5: 30,784,343 H275Y probably benign Het
Ednra A T 8: 77,667,383 N361K probably damaging Het
Ei24 A T 9: 36,784,565 S210R probably damaging Het
Erich3 T A 3: 154,764,804 V158E unknown Het
Fam193a T A 5: 34,466,205 V1379E possibly damaging Het
Fasn A G 11: 120,808,828 V2304A probably damaging Het
Fcgbp A C 7: 28,086,344 D402A probably benign Het
Fkbp14 T C 6: 54,585,945 probably benign Het
Fnip1 G A 11: 54,515,556 V1160I possibly damaging Het
Fsd2 T C 7: 81,552,964 K289R probably null Het
Fuca2 A T 10: 13,505,907 D188V probably damaging Het
Gfpt2 T C 11: 49,810,970 V116A probably benign Het
Gm10770 T A 2: 150,178,896 K234* probably null Het
Gm9887 A G 12: 69,371,989 probably benign Het
Gtf3c2 A G 5: 31,159,233 probably benign Het
H2-M10.3 T C 17: 36,366,636 D250G probably damaging Het
Hapln4 G A 8: 70,084,492 V26M possibly damaging Het
Hook3 G A 8: 26,038,029 A611V probably damaging Het
Hr T C 14: 70,571,972 L1141P probably damaging Het
Ifngr1 T C 10: 19,609,416 S388P probably damaging Het
Itga3 T A 11: 95,061,967 Q326L probably damaging Het
Itgb3 T A 11: 104,665,520 I729N probably damaging Het
Kcnab2 A G 4: 152,401,946 S132P probably damaging Het
Lama3 C T 18: 12,539,793 A2481V probably damaging Het
Lama3 T C 18: 12,498,678 probably benign Het
Lce1e A T 3: 92,707,871 C56* probably null Het
Lmcd1 T C 6: 112,287,871 probably benign Het
Lrrc14 T A 15: 76,713,362 probably null Het
Map4k5 G A 12: 69,818,438 P591L probably benign Het
Mapk13 C A 17: 28,776,310 D168E probably damaging Het
Marf1 A C 16: 14,132,665 H952Q possibly damaging Het
Megf6 T C 4: 154,254,281 probably null Het
Mical3 T C 6: 121,033,787 I411M probably damaging Het
Myo5a A T 9: 75,217,507 K1781N probably damaging Het
N4bp2 T C 5: 65,808,130 V1174A probably benign Het
Ncdn A T 4: 126,750,423 L202Q probably damaging Het
Ncor1 T A 11: 62,392,638 M408L possibly damaging Het
Nf1 T C 11: 79,409,409 L249P probably damaging Het
Nlrp9b T A 7: 20,049,596 probably null Het
Nxpe3 A T 16: 55,849,633 Y370N probably damaging Het
P2rx2 T A 5: 110,341,568 T167S probably benign Het
Pcdhb19 G T 18: 37,499,108 R652L probably benign Het
Pcdhga12 T C 18: 37,768,281 L722P probably benign Het
Pde6a A T 18: 61,245,592 I329F probably damaging Het
Pdpr T A 8: 111,101,951 S29T probably benign Het
Pfkfb3 T C 2: 11,486,312 D173G probably benign Het
Plcd4 A G 1: 74,565,802 probably null Het
Pou2f2 A G 7: 25,097,108 probably benign Het
Ppp1r14c TGGCGGCGGCGGCGGCGG TGGCGGCGGCGGCGG 10: 3,366,702 probably benign Het
Ppp1r42 T C 1: 10,003,386 probably benign Het
Ptpre C T 7: 135,669,132 H346Y probably benign Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Rab12 A T 17: 66,498,108 Y142N probably damaging Het
Rai14 A C 15: 10,572,470 M857R probably damaging Het
Ranbp2 A G 10: 58,492,421 K2753R probably damaging Het
Rasa4 A T 5: 136,103,911 K6* probably null Het
Rasgef1a A G 6: 118,089,139 M438V probably benign Het
Recql T G 6: 142,359,006 probably benign Het
Rftn2 A G 1: 55,172,039 V425A probably benign Het
Ror1 A G 4: 100,409,804 Y234C probably damaging Het
Sap30l T A 11: 57,806,054 L70Q probably damaging Het
Scn4a T C 11: 106,320,002 R1730G probably damaging Het
Serinc5 T G 13: 92,690,980 I268R probably damaging Het
Sin3b G A 8: 72,744,948 V432I possibly damaging Het
Slc30a6 T C 17: 74,412,654 M203T possibly damaging Het
Soat1 T C 1: 156,432,328 N481S probably damaging Het
Sos2 G A 12: 69,640,154 T206I probably benign Het
Sp100 G T 1: 85,705,003 A132S probably benign Het
Spata31d1c T A 13: 65,035,790 L382* probably null Het
Stard9 T A 2: 120,700,860 W2533R probably benign Het
Tas2r126 A G 6: 42,435,390 T286A probably benign Het
Tedc2 T A 17: 24,217,936 K275M probably damaging Het
Ten1 A T 11: 116,218,231 K242N probably benign Het
Tial1 C T 7: 128,455,028 V1I probably damaging Het
Tle2 G A 10: 81,588,891 R649H possibly damaging Het
Tmem178 A G 17: 80,944,945 D86G probably benign Het
Trim29 T A 9: 43,329,575 D528E possibly damaging Het
Vmn2r61 A T 7: 42,300,708 T851S probably benign Het
Vmn2r72 T A 7: 85,750,598 Q414H possibly damaging Het
Yars A T 4: 129,189,882 probably benign Het
Yipf4 A G 17: 74,494,092 Q135R probably damaging Het
Zfp341 G A 2: 154,645,866 probably benign Het
Zfp426 T C 9: 20,470,038 Y536C probably damaging Het
Other mutations in Zp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00402:Zp2 APN 7 120133400 missense probably benign 0.00
IGL00707:Zp2 APN 7 120133413 missense probably benign 0.03
IGL00916:Zp2 APN 7 120138174 missense probably damaging 1.00
IGL01554:Zp2 APN 7 120138325 missense possibly damaging 0.78
IGL01845:Zp2 APN 7 120138191 missense probably damaging 1.00
IGL02111:Zp2 APN 7 120132418 missense possibly damaging 0.75
IGL02145:Zp2 APN 7 120139851 critical splice acceptor site probably null
IGL02155:Zp2 APN 7 120144117 missense probably benign 0.00
IGL02178:Zp2 APN 7 120133750 missense possibly damaging 0.85
IGL02646:Zp2 APN 7 120135341 missense possibly damaging 0.92
IGL03220:Zp2 APN 7 120137227 missense possibly damaging 0.90
R0138:Zp2 UTSW 7 120137200 missense probably damaging 0.96
R0197:Zp2 UTSW 7 120143576 splice site probably benign
R0519:Zp2 UTSW 7 120138149 missense probably damaging 1.00
R0573:Zp2 UTSW 7 120135470 splice site probably benign
R0879:Zp2 UTSW 7 120135534 missense probably damaging 1.00
R0883:Zp2 UTSW 7 120143576 splice site probably benign
R1160:Zp2 UTSW 7 120136045 missense probably damaging 1.00
R1235:Zp2 UTSW 7 120138343 missense possibly damaging 0.57
R1753:Zp2 UTSW 7 120138105 missense probably benign
R1883:Zp2 UTSW 7 120133401 missense probably benign 0.02
R1995:Zp2 UTSW 7 120135165 missense probably damaging 0.97
R2196:Zp2 UTSW 7 120138306 missense probably benign
R2850:Zp2 UTSW 7 120138306 missense probably benign
R3715:Zp2 UTSW 7 120141834 missense possibly damaging 0.95
R3931:Zp2 UTSW 7 120132357 intron probably benign
R4082:Zp2 UTSW 7 120135252 missense probably benign 0.01
R4731:Zp2 UTSW 7 120138120 missense probably damaging 0.96
R4732:Zp2 UTSW 7 120138120 missense probably damaging 0.96
R4733:Zp2 UTSW 7 120138120 missense probably damaging 0.96
R4754:Zp2 UTSW 7 120138318 missense probably benign 0.01
R5274:Zp2 UTSW 7 120138092 missense possibly damaging 0.92
R5392:Zp2 UTSW 7 120135764 nonsense probably null
R5877:Zp2 UTSW 7 120133339 missense probably null 0.94
R6390:Zp2 UTSW 7 120141230 missense probably benign 0.23
R6404:Zp2 UTSW 7 120135542 missense possibly damaging 0.73
R6546:Zp2 UTSW 7 120132525 missense probably benign 0.00
R6622:Zp2 UTSW 7 120132525 missense probably benign 0.00
R6622:Zp2 UTSW 7 120141913 missense probably benign
R6707:Zp2 UTSW 7 120133922 missense possibly damaging 0.85
X0017:Zp2 UTSW 7 120133385 missense probably damaging 1.00
X0023:Zp2 UTSW 7 120133367 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGGCATTTAGTAGCATACTGTCTC -3'
(R):5'- GCCAGCCTATTTTCAAGGTGC -3'

Sequencing Primer
(F):5'- GCATACTGTCTCTGATGTAATAGC -3'
(R):5'- CAGCCTATTTTCAAGGTGCAGTCTG -3'
Posted On2016-03-17