Incidental Mutation 'R4863:Pdpr'
ID374666
Institutional Source Beutler Lab
Gene Symbol Pdpr
Ensembl Gene ENSMUSG00000033624
Gene Namepyruvate dehydrogenase phosphatase regulatory subunit
Synonyms4930402E16Rik
MMRRC Submission 042473-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.275) question?
Stock #R4863 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location111094630-111137074 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 111101951 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 29 (S29T)
Ref Sequence ENSEMBL: ENSMUSP00000117570 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039333] [ENSMUST00000135302] [ENSMUST00000144377]
Predicted Effect probably benign
Transcript: ENSMUST00000039333
AA Change: S29T

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000046639
Gene: ENSMUSG00000033624
AA Change: S29T

DomainStartEndE-ValueType
low complexity region 20 35 N/A INTRINSIC
Pfam:FAD_binding_2 43 235 8.3e-8 PFAM
Pfam:DAO 43 401 1.5e-58 PFAM
Pfam:FAO_M 404 459 1.2e-19 PFAM
Pfam:GCV_T 461 738 4.7e-71 PFAM
Pfam:GCV_T_C 746 854 1.4e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000135302
AA Change: S29T

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000117570
Gene: ENSMUSG00000033624
AA Change: S29T

DomainStartEndE-ValueType
low complexity region 20 35 N/A INTRINSIC
Pfam:DAO 43 145 4.6e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000144377
AA Change: S29T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000121325
Gene: ENSMUSG00000033624
AA Change: S29T

DomainStartEndE-ValueType
low complexity region 20 35 N/A INTRINSIC
Pfam:FAD_binding_2 43 236 2.4e-8 PFAM
Pfam:DAO 43 401 3.3e-72 PFAM
Pfam:GCV_T 522 667 1.4e-29 PFAM
Meta Mutation Damage Score 0.042 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency 99% (105/106)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Pyruvate dehydrogenase complex (PDC) catalyzes the oxidative decarboxylation of pyruvate and links glycolysis to the tricarboxylic acid cycle and fatty acid synthesis. The dephosphorylation and reactivation of PDC is catalyzed by pyruvate dehydrogenase phosphatase (PDP). The dimeric PDP has a catalytic subunit and a regulatory subunit. This gene encodes the FAD-containing regulatory subunit of PDP. The encoded protein acts to decrease the sensitivity of the PDP catalytic subunit to magnesium ions. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jan 2017]
Allele List at MGI
Other mutations in this stock
Total: 98 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210407C18Rik A T 11: 58,612,512 probably null Het
4930578I06Rik C T 14: 63,973,209 R190H probably benign Het
A530032D15Rik C T 1: 85,088,800 probably benign Het
Abcc12 T A 8: 86,538,376 I647F probably damaging Het
Acnat2 C A 4: 49,380,172 W384L probably damaging Het
Acvr1 A G 2: 58,477,711 L146P possibly damaging Het
Ankrd16 T A 2: 11,784,316 M238K probably benign Het
BC005561 A T 5: 104,517,750 D46V possibly damaging Het
Cd3eap T A 7: 19,357,759 Q141L probably damaging Het
Clmn A T 12: 104,797,094 I91N probably damaging Het
Cog8 A T 8: 107,050,174 L523H probably damaging Het
Cpxm2 T A 7: 132,059,747 K437M probably benign Het
Dhx57 A T 17: 80,253,111 V999E probably damaging Het
Dnpep T C 1: 75,309,230 probably benign Het
Dok3 G A 13: 55,523,457 R434W probably damaging Het
Dpysl5 C T 5: 30,784,343 H275Y probably benign Het
Ednra A T 8: 77,667,383 N361K probably damaging Het
Ei24 A T 9: 36,784,565 S210R probably damaging Het
Erich3 T A 3: 154,764,804 V158E unknown Het
Fam193a T A 5: 34,466,205 V1379E possibly damaging Het
Fasn A G 11: 120,808,828 V2304A probably damaging Het
Fcgbp A C 7: 28,086,344 D402A probably benign Het
Fkbp14 T C 6: 54,585,945 probably benign Het
Fnip1 G A 11: 54,515,556 V1160I possibly damaging Het
Fsd2 T C 7: 81,552,964 K289R probably null Het
Fuca2 A T 10: 13,505,907 D188V probably damaging Het
Gfpt2 T C 11: 49,810,970 V116A probably benign Het
Gm10770 T A 2: 150,178,896 K234* probably null Het
Gm9887 A G 12: 69,371,989 probably benign Het
Gtf3c2 A G 5: 31,159,233 probably benign Het
H2-M10.3 T C 17: 36,366,636 D250G probably damaging Het
Hapln4 G A 8: 70,084,492 V26M possibly damaging Het
Hook3 G A 8: 26,038,029 A611V probably damaging Het
Hr T C 14: 70,571,972 L1141P probably damaging Het
Ifngr1 T C 10: 19,609,416 S388P probably damaging Het
Itga3 T A 11: 95,061,967 Q326L probably damaging Het
Itgb3 T A 11: 104,665,520 I729N probably damaging Het
Kcnab2 A G 4: 152,401,946 S132P probably damaging Het
Lama3 T C 18: 12,498,678 probably benign Het
Lama3 C T 18: 12,539,793 A2481V probably damaging Het
Lce1e A T 3: 92,707,871 C56* probably null Het
Lmcd1 T C 6: 112,287,871 probably benign Het
Lrrc14 T A 15: 76,713,362 probably null Het
Map4k5 G A 12: 69,818,438 P591L probably benign Het
Mapk13 C A 17: 28,776,310 D168E probably damaging Het
Marf1 A C 16: 14,132,665 H952Q possibly damaging Het
Megf6 T C 4: 154,254,281 probably null Het
Mical3 T C 6: 121,033,787 I411M probably damaging Het
Myo5a A T 9: 75,217,507 K1781N probably damaging Het
N4bp2 T C 5: 65,808,130 V1174A probably benign Het
Ncdn A T 4: 126,750,423 L202Q probably damaging Het
Ncor1 T A 11: 62,392,638 M408L possibly damaging Het
Nf1 T C 11: 79,409,409 L249P probably damaging Het
Nlrp9b T A 7: 20,049,596 probably null Het
Nxpe3 A T 16: 55,849,633 Y370N probably damaging Het
P2rx2 T A 5: 110,341,568 T167S probably benign Het
Pcdhb19 G T 18: 37,499,108 R652L probably benign Het
Pcdhga12 T C 18: 37,768,281 L722P probably benign Het
Pde6a A T 18: 61,245,592 I329F probably damaging Het
Pfkfb3 T C 2: 11,486,312 D173G probably benign Het
Plcd4 A G 1: 74,565,802 probably null Het
Pou2f2 A G 7: 25,097,108 probably benign Het
Ppp1r14c TGGCGGCGGCGGCGGCGG TGGCGGCGGCGGCGG 10: 3,366,702 probably benign Het
Ppp1r42 T C 1: 10,003,386 probably benign Het
Ptpre C T 7: 135,669,132 H346Y probably benign Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Rab12 A T 17: 66,498,108 Y142N probably damaging Het
Rai14 A C 15: 10,572,470 M857R probably damaging Het
Ranbp2 A G 10: 58,492,421 K2753R probably damaging Het
Rasa4 A T 5: 136,103,911 K6* probably null Het
Rasgef1a A G 6: 118,089,139 M438V probably benign Het
Recql T G 6: 142,359,006 probably benign Het
Rftn2 A G 1: 55,172,039 V425A probably benign Het
Ror1 A G 4: 100,409,804 Y234C probably damaging Het
Sap30l T A 11: 57,806,054 L70Q probably damaging Het
Scn4a T C 11: 106,320,002 R1730G probably damaging Het
Serinc5 T G 13: 92,690,980 I268R probably damaging Het
Sin3b G A 8: 72,744,948 V432I possibly damaging Het
Slc30a6 T C 17: 74,412,654 M203T possibly damaging Het
Soat1 T C 1: 156,432,328 N481S probably damaging Het
Sos2 G A 12: 69,640,154 T206I probably benign Het
Sp100 G T 1: 85,705,003 A132S probably benign Het
Spata31d1c T A 13: 65,035,790 L382* probably null Het
Stard9 T A 2: 120,700,860 W2533R probably benign Het
Tas2r126 A G 6: 42,435,390 T286A probably benign Het
Tedc2 T A 17: 24,217,936 K275M probably damaging Het
Ten1 A T 11: 116,218,231 K242N probably benign Het
Tial1 C T 7: 128,455,028 V1I probably damaging Het
Tle2 G A 10: 81,588,891 R649H possibly damaging Het
Tmem178 A G 17: 80,944,945 D86G probably benign Het
Trim29 T A 9: 43,329,575 D528E possibly damaging Het
Vmn2r61 A T 7: 42,300,708 T851S probably benign Het
Vmn2r72 T A 7: 85,750,598 Q414H possibly damaging Het
Yars A T 4: 129,189,882 probably benign Het
Yipf4 A G 17: 74,494,092 Q135R probably damaging Het
Zfp341 G A 2: 154,645,866 probably benign Het
Zfp426 T C 9: 20,470,038 Y536C probably damaging Het
Zp2 T G 7: 120,135,772 Y430S probably damaging Het
Other mutations in Pdpr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00155:Pdpr APN 8 111102072 missense possibly damaging 0.69
IGL01116:Pdpr APN 8 111112710 missense possibly damaging 0.84
IGL01353:Pdpr APN 8 111121278 splice site probably null
IGL01681:Pdpr APN 8 111132936 missense probably damaging 1.00
IGL01785:Pdpr APN 8 111129656 missense probably damaging 0.98
IGL02115:Pdpr APN 8 111103998 missense probably damaging 1.00
IGL02292:Pdpr APN 8 111125680 missense probably damaging 1.00
IGL02749:Pdpr APN 8 111118090 missense probably benign 0.01
IGL03296:Pdpr APN 8 111114798 missense probably damaging 1.00
R0730:Pdpr UTSW 8 111125755 critical splice donor site probably null
R1510:Pdpr UTSW 8 111124475 splice site probably benign
R1837:Pdpr UTSW 8 111134734 missense probably damaging 1.00
R1838:Pdpr UTSW 8 111134734 missense probably damaging 1.00
R2144:Pdpr UTSW 8 111118036 missense probably damaging 0.97
R4214:Pdpr UTSW 8 111129580 intron probably benign
R4812:Pdpr UTSW 8 111116717 missense probably benign 0.00
R4998:Pdpr UTSW 8 111114768 missense probably damaging 1.00
R5579:Pdpr UTSW 8 111123816 missense probably damaging 1.00
R5665:Pdpr UTSW 8 111114811 missense possibly damaging 0.55
R5739:Pdpr UTSW 8 111134620 missense possibly damaging 0.78
R6675:Pdpr UTSW 8 111101900 nonsense probably null
R6785:Pdpr UTSW 8 111124611 missense probably benign 0.00
R6889:Pdpr UTSW 8 111124613 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TCGCATAAAGGGCTATTGTTCTATG -3'
(R):5'- ACTGTCATTGCAGCCAAACC -3'

Sequencing Primer
(F):5'- TCTCATTAGTCCTGAGAACGGAC -3'
(R):5'- CCCAAGGCAAGTCAATTTGATC -3'
Posted On2016-03-17