Incidental Mutation 'R4863:Myo5a'
ID374670
Institutional Source Beutler Lab
Gene Symbol Myo5a
Ensembl Gene ENSMUSG00000034593
Gene Namemyosin VA
Synonyms9630007J19Rik, Dbv, flail, MVa, Myo5, MyoVA
MMRRC Submission 042473-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.890) question?
Stock #R4863 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location75071015-75223688 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 75217507 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Asparagine at position 1781 (K1781N)
Ref Sequence ENSEMBL: ENSMUSP00000117493 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000123128] [ENSMUST00000136731] [ENSMUST00000148144] [ENSMUST00000155282]
Predicted Effect probably damaging
Transcript: ENSMUST00000123128
AA Change: K1779N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000116028
Gene: ENSMUSG00000034593
AA Change: K1779N

DomainStartEndE-ValueType
MYSc 63 764 N/A SMART
IQ 765 787 3.65e-4 SMART
IQ 788 810 1.56e-3 SMART
IQ 813 835 3.05e-6 SMART
IQ 836 858 8.38e-4 SMART
IQ 861 883 1.09e-2 SMART
IQ 884 906 6.97e0 SMART
coiled coil region 1153 1234 N/A INTRINSIC
coiled coil region 1314 1364 N/A INTRINSIC
coiled coil region 1406 1443 N/A INTRINSIC
DIL 1685 1790 2.47e-51 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136604
Predicted Effect probably damaging
Transcript: ENSMUST00000136731
AA Change: K1754N

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000120444
Gene: ENSMUSG00000034593
AA Change: K1754N

DomainStartEndE-ValueType
MYSc 63 764 N/A SMART
IQ 765 787 3.65e-4 SMART
IQ 788 810 1.56e-3 SMART
IQ 813 835 3.05e-6 SMART
IQ 836 858 8.38e-4 SMART
IQ 861 883 1.09e-2 SMART
IQ 884 906 6.97e0 SMART
coiled coil region 1153 1234 N/A INTRINSIC
coiled coil region 1314 1418 N/A INTRINSIC
DIL 1660 1765 2.47e-51 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000148144
AA Change: K511N

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000121158
Gene: ENSMUSG00000034593
AA Change: K511N

DomainStartEndE-ValueType
coiled coil region 71 175 N/A INTRINSIC
Blast:DIL 275 305 4e-13 BLAST
Blast:DIL 330 355 5e-6 BLAST
DIL 417 522 2.47e-51 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000155282
AA Change: K1781N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000117493
Gene: ENSMUSG00000034593
AA Change: K1781N

DomainStartEndE-ValueType
MYSc 63 764 N/A SMART
IQ 765 787 3.65e-4 SMART
IQ 788 810 1.56e-3 SMART
IQ 813 835 3.05e-6 SMART
IQ 836 858 8.38e-4 SMART
IQ 861 883 1.09e-2 SMART
IQ 884 906 6.97e0 SMART
coiled coil region 1153 1234 N/A INTRINSIC
coiled coil region 1339 1445 N/A INTRINSIC
DIL 1687 1792 2.47e-51 SMART
Meta Mutation Damage Score 0.134 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency 99% (105/106)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is one of three myosin V heavy-chain genes, belonging to the myosin gene superfamily. Myosin V is a class of actin-based motor proteins involved in cytoplasmic vesicle transport and anchorage, spindle-pole alignment and mRNA translocation. The protein encoded by this gene is abundant in melanocytes and nerve cells. Mutations in this gene cause Griscelli syndrome type-1 (GS1), Griscelli syndrome type-3 (GS3) and neuroectodermal melanolysosomal disease, or Elejalde disease. Multiple alternatively spliced transcript variants encoding different isoforms have been reported, but the full-length nature of some variants has not been determined. [provided by RefSeq, Dec 2008]
PHENOTYPE: Mutations in this gene result in diluted coat color, behavioral deficits including opisthotonus, and postnatal or premature death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 98 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210407C18Rik A T 11: 58,612,512 probably null Het
4930578I06Rik C T 14: 63,973,209 R190H probably benign Het
A530032D15Rik C T 1: 85,088,800 probably benign Het
Abcc12 T A 8: 86,538,376 I647F probably damaging Het
Acnat2 C A 4: 49,380,172 W384L probably damaging Het
Acvr1 A G 2: 58,477,711 L146P possibly damaging Het
Ankrd16 T A 2: 11,784,316 M238K probably benign Het
BC005561 A T 5: 104,517,750 D46V possibly damaging Het
Cd3eap T A 7: 19,357,759 Q141L probably damaging Het
Clmn A T 12: 104,797,094 I91N probably damaging Het
Cog8 A T 8: 107,050,174 L523H probably damaging Het
Cpxm2 T A 7: 132,059,747 K437M probably benign Het
Dhx57 A T 17: 80,253,111 V999E probably damaging Het
Dnpep T C 1: 75,309,230 probably benign Het
Dok3 G A 13: 55,523,457 R434W probably damaging Het
Dpysl5 C T 5: 30,784,343 H275Y probably benign Het
Ednra A T 8: 77,667,383 N361K probably damaging Het
Ei24 A T 9: 36,784,565 S210R probably damaging Het
Erich3 T A 3: 154,764,804 V158E unknown Het
Fam193a T A 5: 34,466,205 V1379E possibly damaging Het
Fasn A G 11: 120,808,828 V2304A probably damaging Het
Fcgbp A C 7: 28,086,344 D402A probably benign Het
Fkbp14 T C 6: 54,585,945 probably benign Het
Fnip1 G A 11: 54,515,556 V1160I possibly damaging Het
Fsd2 T C 7: 81,552,964 K289R probably null Het
Fuca2 A T 10: 13,505,907 D188V probably damaging Het
Gfpt2 T C 11: 49,810,970 V116A probably benign Het
Gm10770 T A 2: 150,178,896 K234* probably null Het
Gm9887 A G 12: 69,371,989 probably benign Het
Gtf3c2 A G 5: 31,159,233 probably benign Het
H2-M10.3 T C 17: 36,366,636 D250G probably damaging Het
Hapln4 G A 8: 70,084,492 V26M possibly damaging Het
Hook3 G A 8: 26,038,029 A611V probably damaging Het
Hr T C 14: 70,571,972 L1141P probably damaging Het
Ifngr1 T C 10: 19,609,416 S388P probably damaging Het
Itga3 T A 11: 95,061,967 Q326L probably damaging Het
Itgb3 T A 11: 104,665,520 I729N probably damaging Het
Kcnab2 A G 4: 152,401,946 S132P probably damaging Het
Lama3 C T 18: 12,539,793 A2481V probably damaging Het
Lama3 T C 18: 12,498,678 probably benign Het
Lce1e A T 3: 92,707,871 C56* probably null Het
Lmcd1 T C 6: 112,287,871 probably benign Het
Lrrc14 T A 15: 76,713,362 probably null Het
Map4k5 G A 12: 69,818,438 P591L probably benign Het
Mapk13 C A 17: 28,776,310 D168E probably damaging Het
Marf1 A C 16: 14,132,665 H952Q possibly damaging Het
Megf6 T C 4: 154,254,281 probably null Het
Mical3 T C 6: 121,033,787 I411M probably damaging Het
N4bp2 T C 5: 65,808,130 V1174A probably benign Het
Ncdn A T 4: 126,750,423 L202Q probably damaging Het
Ncor1 T A 11: 62,392,638 M408L possibly damaging Het
Nf1 T C 11: 79,409,409 L249P probably damaging Het
Nlrp9b T A 7: 20,049,596 probably null Het
Nxpe3 A T 16: 55,849,633 Y370N probably damaging Het
P2rx2 T A 5: 110,341,568 T167S probably benign Het
Pcdhb19 G T 18: 37,499,108 R652L probably benign Het
Pcdhga12 T C 18: 37,768,281 L722P probably benign Het
Pde6a A T 18: 61,245,592 I329F probably damaging Het
Pdpr T A 8: 111,101,951 S29T probably benign Het
Pfkfb3 T C 2: 11,486,312 D173G probably benign Het
Plcd4 A G 1: 74,565,802 probably null Het
Pou2f2 A G 7: 25,097,108 probably benign Het
Ppp1r14c TGGCGGCGGCGGCGGCGG TGGCGGCGGCGGCGG 10: 3,366,702 probably benign Het
Ppp1r42 T C 1: 10,003,386 probably benign Het
Ptpre C T 7: 135,669,132 H346Y probably benign Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Rab12 A T 17: 66,498,108 Y142N probably damaging Het
Rai14 A C 15: 10,572,470 M857R probably damaging Het
Ranbp2 A G 10: 58,492,421 K2753R probably damaging Het
Rasa4 A T 5: 136,103,911 K6* probably null Het
Rasgef1a A G 6: 118,089,139 M438V probably benign Het
Recql T G 6: 142,359,006 probably benign Het
Rftn2 A G 1: 55,172,039 V425A probably benign Het
Ror1 A G 4: 100,409,804 Y234C probably damaging Het
Sap30l T A 11: 57,806,054 L70Q probably damaging Het
Scn4a T C 11: 106,320,002 R1730G probably damaging Het
Serinc5 T G 13: 92,690,980 I268R probably damaging Het
Sin3b G A 8: 72,744,948 V432I possibly damaging Het
Slc30a6 T C 17: 74,412,654 M203T possibly damaging Het
Soat1 T C 1: 156,432,328 N481S probably damaging Het
Sos2 G A 12: 69,640,154 T206I probably benign Het
Sp100 G T 1: 85,705,003 A132S probably benign Het
Spata31d1c T A 13: 65,035,790 L382* probably null Het
Stard9 T A 2: 120,700,860 W2533R probably benign Het
Tas2r126 A G 6: 42,435,390 T286A probably benign Het
Tedc2 T A 17: 24,217,936 K275M probably damaging Het
Ten1 A T 11: 116,218,231 K242N probably benign Het
Tial1 C T 7: 128,455,028 V1I probably damaging Het
Tle2 G A 10: 81,588,891 R649H possibly damaging Het
Tmem178 A G 17: 80,944,945 D86G probably benign Het
Trim29 T A 9: 43,329,575 D528E possibly damaging Het
Vmn2r61 A T 7: 42,300,708 T851S probably benign Het
Vmn2r72 T A 7: 85,750,598 Q414H possibly damaging Het
Yars A T 4: 129,189,882 probably benign Het
Yipf4 A G 17: 74,494,092 Q135R probably damaging Het
Zfp341 G A 2: 154,645,866 probably benign Het
Zfp426 T C 9: 20,470,038 Y536C probably damaging Het
Zp2 T G 7: 120,135,772 Y430S probably damaging Het
Other mutations in Myo5a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Myo5a APN 9 75161497 nonsense probably null
IGL00547:Myo5a APN 9 75141453 missense probably benign 0.00
IGL00788:Myo5a APN 9 75168959 missense probably benign 0.15
IGL01327:Myo5a APN 9 75187538 splice site probably benign
IGL01687:Myo5a APN 9 75156249 missense probably benign 0.12
IGL01886:Myo5a APN 9 75169090 splice site probably benign
IGL01945:Myo5a APN 9 75140671 missense probably damaging 1.00
IGL02127:Myo5a APN 9 75212981 missense probably benign 0.12
IGL02137:Myo5a APN 9 75161535 splice site probably null
IGL02183:Myo5a APN 9 75167236 splice site probably benign
IGL02427:Myo5a APN 9 75176618 splice site probably benign
IGL02490:Myo5a APN 9 75136455 missense probably damaging 1.00
IGL02574:Myo5a APN 9 75211147 missense probably benign 0.00
IGL02886:Myo5a APN 9 75151887 splice site probably benign
IGL02961:Myo5a APN 9 75215120 missense probably benign 0.04
IGL03090:Myo5a APN 9 75120833 missense probably damaging 1.00
IGL03119:Myo5a APN 9 75174015 missense probably benign 0.01
IGL03237:Myo5a APN 9 75129994 missense probably damaging 1.00
IGL03296:Myo5a APN 9 75116202 missense probably damaging 1.00
naoki UTSW 9 75161492 missense probably damaging 1.00
new_gray UTSW 9 missense
nut UTSW 9 splice donor site
silver_decerebrate UTSW 9 75164195 missense probably damaging 1.00
silver_decerebrate_2 UTSW 9 75211127 missense probably damaging 1.00
IGL02988:Myo5a UTSW 9 75130141 splice site probably benign
R0047:Myo5a UTSW 9 75156207 missense probably damaging 1.00
R0047:Myo5a UTSW 9 75156207 missense probably damaging 1.00
R0091:Myo5a UTSW 9 75161492 missense probably damaging 1.00
R0142:Myo5a UTSW 9 75160574 missense probably benign 0.01
R0243:Myo5a UTSW 9 75186123 critical splice donor site probably null
R0395:Myo5a UTSW 9 75193977 missense probably benign 0.39
R0427:Myo5a UTSW 9 75174196 missense probably benign 0.00
R0545:Myo5a UTSW 9 75167037 missense possibly damaging 0.94
R0565:Myo5a UTSW 9 75180112 missense probably benign 0.00
R0601:Myo5a UTSW 9 75174015 missense probably benign 0.01
R1457:Myo5a UTSW 9 75213065 missense probably damaging 0.99
R1510:Myo5a UTSW 9 75171551 missense probably benign
R1548:Myo5a UTSW 9 75171746 missense probably damaging 1.00
R1759:Myo5a UTSW 9 75181993 missense possibly damaging 0.72
R1924:Myo5a UTSW 9 75116207 missense probably damaging 1.00
R1960:Myo5a UTSW 9 75147857 missense probably damaging 1.00
R2050:Myo5a UTSW 9 75146874 missense probably benign 0.01
R2070:Myo5a UTSW 9 75181984 missense probably benign 0.03
R2075:Myo5a UTSW 9 75189918 missense probably benign 0.01
R2148:Myo5a UTSW 9 75180147 missense probably damaging 1.00
R2201:Myo5a UTSW 9 75217943 missense possibly damaging 0.51
R2337:Myo5a UTSW 9 75203801 missense probably damaging 1.00
R2357:Myo5a UTSW 9 75201365 missense probably damaging 0.99
R2392:Myo5a UTSW 9 75209239 missense probably benign 0.02
R2432:Myo5a UTSW 9 75212873 missense possibly damaging 0.89
R2568:Myo5a UTSW 9 75123040 missense probably damaging 1.00
R2568:Myo5a UTSW 9 75151897 missense probably damaging 1.00
R2932:Myo5a UTSW 9 75196136 missense possibly damaging 0.85
R2971:Myo5a UTSW 9 75116202 missense probably damaging 1.00
R4231:Myo5a UTSW 9 75189997 missense possibly damaging 0.67
R4293:Myo5a UTSW 9 75144171 missense probably benign
R4321:Myo5a UTSW 9 75217530 missense probably damaging 0.99
R4450:Myo5a UTSW 9 75167176 missense probably benign 0.00
R4573:Myo5a UTSW 9 75201297 synonymous probably null
R4577:Myo5a UTSW 9 75217545 missense probably damaging 1.00
R4601:Myo5a UTSW 9 75136388 missense probably damaging 1.00
R4690:Myo5a UTSW 9 75153823 missense probably damaging 0.99
R4691:Myo5a UTSW 9 75180156 missense probably damaging 0.99
R4764:Myo5a UTSW 9 75116336 intron probably benign
R4767:Myo5a UTSW 9 75144076 missense probably damaging 0.99
R4811:Myo5a UTSW 9 75141543 critical splice donor site probably null
R4829:Myo5a UTSW 9 75136407 missense probably damaging 1.00
R4902:Myo5a UTSW 9 75174078 missense probably benign
R4947:Myo5a UTSW 9 75123048 missense probably damaging 1.00
R5074:Myo5a UTSW 9 75174156 missense probably benign
R5095:Myo5a UTSW 9 75152020 missense probably damaging 1.00
R5095:Myo5a UTSW 9 75184389 nonsense probably null
R5254:Myo5a UTSW 9 75130120 missense probably damaging 1.00
R5267:Myo5a UTSW 9 75152010 missense probably damaging 1.00
R5419:Myo5a UTSW 9 75147897 missense probably damaging 1.00
R5514:Myo5a UTSW 9 75153766 missense probably damaging 1.00
R5629:Myo5a UTSW 9 75203845 missense possibly damaging 0.89
R5649:Myo5a UTSW 9 75171719 missense possibly damaging 0.92
R5661:Myo5a UTSW 9 75167206 missense probably benign 0.02
R5665:Myo5a UTSW 9 75144181 critical splice donor site probably null
R5719:Myo5a UTSW 9 75151931 missense probably damaging 1.00
R5964:Myo5a UTSW 9 75203833 missense probably benign 0.09
R6014:Myo5a UTSW 9 75167207 nonsense probably null
R6344:Myo5a UTSW 9 75160509 missense probably benign 0.09
R6345:Myo5a UTSW 9 75189913 missense possibly damaging 0.77
R6644:Myo5a UTSW 9 75146967 missense probably damaging 0.98
R6712:Myo5a UTSW 9 75212900 missense probably benign 0.12
R6838:Myo5a UTSW 9 75153883 critical splice donor site probably null
R6866:Myo5a UTSW 9 75140688 missense probably damaging 1.00
R6876:Myo5a UTSW 9 75160490 missense probably benign 0.04
X0010:Myo5a UTSW 9 75185905 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAATAGGGGCACTTTTCCCC -3'
(R):5'- GTATCAATCCTTCCAACTTGCAAG -3'

Sequencing Primer
(F):5'- GGCACTTTTCCCCGAGTTATATTTTG -3'
(R):5'- CCTTCCAACTTGCAAGATATTTTTC -3'
Posted On2016-03-17