Incidental Mutation 'R4863:Fnip1'
ID374677
Institutional Source Beutler Lab
Gene Symbol Fnip1
Ensembl Gene ENSMUSG00000035992
Gene Namefolliculin interacting protein 1
SynonymsA730024A03Rik
MMRRC Submission 042473-MU
Accession Numbers

Ncbi RefSeq: NM_173753.4; MGI:2444668

Is this an essential gene? Possibly essential (E-score: 0.642) question?
Stock #R4863 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location54438199-54518235 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 54515556 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 1160 (V1160I)
Ref Sequence ENSEMBL: ENSMUSP00000049026 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046835]
Predicted Effect possibly damaging
Transcript: ENSMUST00000046835
AA Change: V1160I

PolyPhen 2 Score 0.521 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000049026
Gene: ENSMUSG00000035992
AA Change: V1160I

DomainStartEndE-ValueType
Pfam:FNIP_N 41 159 1.7e-29 PFAM
Pfam:FNIP_M 316 549 9.9e-92 PFAM
Pfam:FNIP_C 975 1161 7.6e-73 PFAM
Meta Mutation Damage Score 0.362 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency 99% (105/106)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the folliculin-interacting protein family. The encoded protein binds to the tumor suppressor folliculin and to AMP-activated protein kinase (AMPK) and be involved in cellular metabolism and nutrient sensing by regulating the AMPK-mechanistic target of rapamycin signaling pathway. A homologous binding partner of this protein, folliculin-interacting protein 2, has similar binding activities and may suggest functional redundancy within this protein family. Both folliculin-interacting proteins have also been shown to bind the molecular chaperone heat shock protein-90 (Hsp90) and they may function as a co-chaperones in the stabilization of tumor suppressor folliculin which is a target of Hsp90 chaperone activity. [provided by RefSeq, Sep 2016]
PHENOTYPE: Mice homozygous for an ENU-induced or targeted allele exhibit arrested B cell development at the pre-B cell stage with increased B cell apoptosis. [provided by MGI curators]
Allele List at MGI

All alleles(3) : Targeted(1) Gene trapped(2)

Other mutations in this stock
Total: 98 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210407C18Rik A T 11: 58,612,512 probably null Het
4930578I06Rik C T 14: 63,973,209 R190H probably benign Het
A530032D15Rik C T 1: 85,088,800 probably benign Het
Abcc12 T A 8: 86,538,376 I647F probably damaging Het
Acnat2 C A 4: 49,380,172 W384L probably damaging Het
Acvr1 A G 2: 58,477,711 L146P possibly damaging Het
Ankrd16 T A 2: 11,784,316 M238K probably benign Het
BC005561 A T 5: 104,517,750 D46V possibly damaging Het
Cd3eap T A 7: 19,357,759 Q141L probably damaging Het
Clmn A T 12: 104,797,094 I91N probably damaging Het
Cog8 A T 8: 107,050,174 L523H probably damaging Het
Cpxm2 T A 7: 132,059,747 K437M probably benign Het
Dhx57 A T 17: 80,253,111 V999E probably damaging Het
Dnpep T C 1: 75,309,230 probably benign Het
Dok3 G A 13: 55,523,457 R434W probably damaging Het
Dpysl5 C T 5: 30,784,343 H275Y probably benign Het
Ednra A T 8: 77,667,383 N361K probably damaging Het
Ei24 A T 9: 36,784,565 S210R probably damaging Het
Erich3 T A 3: 154,764,804 V158E unknown Het
Fam193a T A 5: 34,466,205 V1379E possibly damaging Het
Fasn A G 11: 120,808,828 V2304A probably damaging Het
Fcgbp A C 7: 28,086,344 D402A probably benign Het
Fkbp14 T C 6: 54,585,945 probably benign Het
Fsd2 T C 7: 81,552,964 K289R probably null Het
Fuca2 A T 10: 13,505,907 D188V probably damaging Het
Gfpt2 T C 11: 49,810,970 V116A probably benign Het
Gm10770 T A 2: 150,178,896 K234* probably null Het
Gm9887 A G 12: 69,371,989 probably benign Het
Gtf3c2 A G 5: 31,159,233 probably benign Het
H2-M10.3 T C 17: 36,366,636 D250G probably damaging Het
Hapln4 G A 8: 70,084,492 V26M possibly damaging Het
Hook3 G A 8: 26,038,029 A611V probably damaging Het
Hr T C 14: 70,571,972 L1141P probably damaging Het
Ifngr1 T C 10: 19,609,416 S388P probably damaging Het
Itga3 T A 11: 95,061,967 Q326L probably damaging Het
Itgb3 T A 11: 104,665,520 I729N probably damaging Het
Kcnab2 A G 4: 152,401,946 S132P probably damaging Het
Lama3 C T 18: 12,539,793 A2481V probably damaging Het
Lama3 T C 18: 12,498,678 probably benign Het
Lce1e A T 3: 92,707,871 C56* probably null Het
Lmcd1 T C 6: 112,287,871 probably benign Het
Lrrc14 T A 15: 76,713,362 probably null Het
Map4k5 G A 12: 69,818,438 P591L probably benign Het
Mapk13 C A 17: 28,776,310 D168E probably damaging Het
Marf1 A C 16: 14,132,665 H952Q possibly damaging Het
Megf6 T C 4: 154,254,281 probably null Het
Mical3 T C 6: 121,033,787 I411M probably damaging Het
Myo5a A T 9: 75,217,507 K1781N probably damaging Het
N4bp2 T C 5: 65,808,130 V1174A probably benign Het
Ncdn A T 4: 126,750,423 L202Q probably damaging Het
Ncor1 T A 11: 62,392,638 M408L possibly damaging Het
Nf1 T C 11: 79,409,409 L249P probably damaging Het
Nlrp9b T A 7: 20,049,596 probably null Het
Nxpe3 A T 16: 55,849,633 Y370N probably damaging Het
P2rx2 T A 5: 110,341,568 T167S probably benign Het
Pcdhb19 G T 18: 37,499,108 R652L probably benign Het
Pcdhga12 T C 18: 37,768,281 L722P probably benign Het
Pde6a A T 18: 61,245,592 I329F probably damaging Het
Pdpr T A 8: 111,101,951 S29T probably benign Het
Pfkfb3 T C 2: 11,486,312 D173G probably benign Het
Plcd4 A G 1: 74,565,802 probably null Het
Pou2f2 A G 7: 25,097,108 probably benign Het
Ppp1r14c TGGCGGCGGCGGCGGCGG TGGCGGCGGCGGCGG 10: 3,366,702 probably benign Het
Ppp1r42 T C 1: 10,003,386 probably benign Het
Ptpre C T 7: 135,669,132 H346Y probably benign Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Rab12 A T 17: 66,498,108 Y142N probably damaging Het
Rai14 A C 15: 10,572,470 M857R probably damaging Het
Ranbp2 A G 10: 58,492,421 K2753R probably damaging Het
Rasa4 A T 5: 136,103,911 K6* probably null Het
Rasgef1a A G 6: 118,089,139 M438V probably benign Het
Recql T G 6: 142,359,006 probably benign Het
Rftn2 A G 1: 55,172,039 V425A probably benign Het
Ror1 A G 4: 100,409,804 Y234C probably damaging Het
Sap30l T A 11: 57,806,054 L70Q probably damaging Het
Scn4a T C 11: 106,320,002 R1730G probably damaging Het
Serinc5 T G 13: 92,690,980 I268R probably damaging Het
Sin3b G A 8: 72,744,948 V432I possibly damaging Het
Slc30a6 T C 17: 74,412,654 M203T possibly damaging Het
Soat1 T C 1: 156,432,328 N481S probably damaging Het
Sos2 G A 12: 69,640,154 T206I probably benign Het
Sp100 G T 1: 85,705,003 A132S probably benign Het
Spata31d1c T A 13: 65,035,790 L382* probably null Het
Stard9 T A 2: 120,700,860 W2533R probably benign Het
Tas2r126 A G 6: 42,435,390 T286A probably benign Het
Tedc2 T A 17: 24,217,936 K275M probably damaging Het
Ten1 A T 11: 116,218,231 K242N probably benign Het
Tial1 C T 7: 128,455,028 V1I probably damaging Het
Tle2 G A 10: 81,588,891 R649H possibly damaging Het
Tmem178 A G 17: 80,944,945 D86G probably benign Het
Trim29 T A 9: 43,329,575 D528E possibly damaging Het
Vmn2r61 A T 7: 42,300,708 T851S probably benign Het
Vmn2r72 T A 7: 85,750,598 Q414H possibly damaging Het
Yars A T 4: 129,189,882 probably benign Het
Yipf4 A G 17: 74,494,092 Q135R probably damaging Het
Zfp341 G A 2: 154,645,866 probably benign Het
Zfp426 T C 9: 20,470,038 Y536C probably damaging Het
Zp2 T G 7: 120,135,772 Y430S probably damaging Het
Other mutations in Fnip1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01449:Fnip1 APN 11 54499508 missense probably damaging 1.00
IGL01590:Fnip1 APN 11 54493300 missense probably damaging 1.00
IGL01959:Fnip1 APN 11 54490912 missense possibly damaging 0.95
IGL02157:Fnip1 APN 11 54487763 missense probably damaging 1.00
IGL02197:Fnip1 APN 11 54493374 missense probably damaging 1.00
IGL02476:Fnip1 APN 11 54499567 splice site probably benign
IGL02639:Fnip1 APN 11 54475640 nonsense probably null
IGL02742:Fnip1 APN 11 54493351 missense probably damaging 1.00
hamel UTSW 11 54480685 critical splice donor site probably benign
hamel2 UTSW 11 54502271 missense probably damaging 1.00
Normandy UTSW 11 54493181 splice site probably benign
H8562:Fnip1 UTSW 11 54480297 missense probably damaging 0.98
P0043:Fnip1 UTSW 11 54503225 missense probably benign 0.00
R0114:Fnip1 UTSW 11 54487801 splice site probably benign
R0278:Fnip1 UTSW 11 54489343 splice site probably null
R0409:Fnip1 UTSW 11 54480354 splice site probably null
R0840:Fnip1 UTSW 11 54493181 splice site probably benign
R1131:Fnip1 UTSW 11 54493303 missense possibly damaging 0.82
R1205:Fnip1 UTSW 11 54502306 missense possibly damaging 0.91
R1271:Fnip1 UTSW 11 54503297 missense probably benign
R1817:Fnip1 UTSW 11 54502453 missense probably benign 0.30
R1826:Fnip1 UTSW 11 54466164 missense probably damaging 1.00
R1872:Fnip1 UTSW 11 54487735 missense probably damaging 1.00
R1883:Fnip1 UTSW 11 54515547 missense probably damaging 1.00
R1917:Fnip1 UTSW 11 54480684 missense probably damaging 0.99
R1918:Fnip1 UTSW 11 54480684 missense probably damaging 0.99
R1919:Fnip1 UTSW 11 54480684 missense probably damaging 0.99
R2010:Fnip1 UTSW 11 54482503 missense probably damaging 1.00
R2117:Fnip1 UTSW 11 54500624 missense probably damaging 1.00
R2329:Fnip1 UTSW 11 54466107 missense probably damaging 0.98
R2337:Fnip1 UTSW 11 54475737 missense probably damaging 0.98
R2850:Fnip1 UTSW 11 54502677 missense probably benign 0.32
R2863:Fnip1 UTSW 11 54502424 missense probably damaging 1.00
R2864:Fnip1 UTSW 11 54502424 missense probably damaging 1.00
R2865:Fnip1 UTSW 11 54502424 missense probably damaging 1.00
R3936:Fnip1 UTSW 11 54480239 splice site probably null
R4017:Fnip1 UTSW 11 54509987 missense probably benign 0.14
R4033:Fnip1 UTSW 11 54502471 missense probably benign 0.02
R4668:Fnip1 UTSW 11 54503559 missense probably damaging 1.00
R4695:Fnip1 UTSW 11 54499419 missense probably damaging 1.00
R4762:Fnip1 UTSW 11 54466171 missense probably damaging 1.00
R4762:Fnip1 UTSW 11 54499526 missense probably benign 0.01
R4777:Fnip1 UTSW 11 54500556 missense probably damaging 1.00
R5369:Fnip1 UTSW 11 54502589 missense probably benign
R5481:Fnip1 UTSW 11 54502644 missense probably benign 0.01
R5562:Fnip1 UTSW 11 54489342 critical splice donor site probably null
R5563:Fnip1 UTSW 11 54504862 missense probably benign 0.05
R5628:Fnip1 UTSW 11 54503633 missense probably benign 0.08
R5689:Fnip1 UTSW 11 54502289 missense probably damaging 1.00
R6009:Fnip1 UTSW 11 54502271 missense probably damaging 1.00
R6120:Fnip1 UTSW 11 54510000 missense probably benign 0.23
R6429:Fnip1 UTSW 11 54515567 missense probably damaging 1.00
R6546:Fnip1 UTSW 11 54502611 missense probably benign 0.03
R6600:Fnip1 UTSW 11 54503099 missense probably benign
R6882:Fnip1 UTSW 11 54509898 missense probably damaging 1.00
R6966:Fnip1 UTSW 11 54482559 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ACTGTTGGTGAAATTTTCCAGG -3'
(R):5'- ACCACTGCTCAGATGTCCAG -3'

Sequencing Primer
(F):5'- GCTTTTGTCTAGGATAAGCACC -3'
(R):5'- GCGTTCACCTAAAGCGTA -3'
Posted On2016-03-17